G1254656



Basic Information


Item Value
gene id G1254656
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 7912048 ~ 7912381 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1433296
ACCTAGAAAGAATAACGCTAACTGATATCTCAACTAACCTAGAAAGAATAACGCTAACTGATATCTCAACTAACCTAGAAAGAATAACGCTAACTGATATCTCAACTAACCTAGAAAGAATAACGCTAACTGATATCTCAACTAACCTAGAAAGAATAACGCTAACTGATATCTCAACTAACCTAGAAAGTATAACGCTAACTGATATCTCAACTAACCTAGAAAGAATAACGCTAACTGATATCTCAACTAACCTAGAAAGAATAACGCTAACTGATATCTCTACTAACCTAGAAAGAATAACGCTAACTGATATCTCTACTAACCTAGAAAG

Function


NR:

description
PREDICTED: stress response protein NST1-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1433296 True 334 lncRNA 0.34 1 7912048 7912381

Neighbor


gene id symbol gene type direction distance location
LOC110490896 NA coding upstream 45970 7863667 ~ 7866078 (+)
LOC110489541 arhgap29 coding upstream 772485 7110207 ~ 7139563 (+)
LOC110489539 LOC106590649 coding upstream 826160 7075115 ~ 7085888 (+)
LOC110490889 LOC106578491 coding upstream 874289 7008276 ~ 7037759 (+)
alg14 alg14 coding upstream 909984 6997759 ~ 7002064 (+)
LOC110489552 LOC106590631 coding downstream 529278 8441659 ~ 8453058 (+)
LOC110489555 LOC106590626 coding downstream 717972 8630353 ~ 8649744 (+)
LOC110489556 LOC106590625 coding downstream 756700 8669081 ~ 8672326 (+)
LOC110490900 dok6 coding downstream 911135 8823516 ~ 8956345 (+)
LOC110489557 LOC106590621 coding downstream 1138163 9050544 ~ 9061028 (+)
G1254639 NA non-coding upstream 13199 7881549 ~ 7898849 (+)
G1254644 NA non-coding upstream 21759 7889870 ~ 7890289 (+)
G1254631 NA non-coding upstream 35996 7874949 ~ 7876052 (+)
G1254630 NA non-coding upstream 40554 7871011 ~ 7871494 (+)
G1254612 NA non-coding upstream 62797 7846995 ~ 7849251 (+)
G1254677 NA non-coding downstream 42341 7954722 ~ 7954930 (+)
G1254679 NA non-coding downstream 43552 7955933 ~ 7956379 (+)
G1254680 NA non-coding downstream 47146 7959527 ~ 7959747 (+)
G1254683 NA non-coding downstream 56803 7969184 ~ 7969455 (+)
G1254686 NA non-coding downstream 59006 7971387 ~ 7971626 (+)
G1253720 LOC106590648 other upstream 823013 7086331 ~ 7089035 (+)
G1253703 LOC106590651 other upstream 943632 6964482 ~ 6968416 (+)
LOC110490886 LOC106590655 other upstream 1583974 6242892 ~ 6328082 (+)
G1255589 NA other downstream 1106864 9019245 ~ 9019731 (+)
G1257500 NA other downstream 3222463 11134844 ~ 11135414 (+)
G1257551 NA other downstream 3339546 11251927 ~ 11269539 (+)
LOC110489585 dap1 other downstream 3528967 11441274 ~ 11461528 (+)

Expression


G1254656 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1254656 Expression in each Bioproject

Bar chart with 4 bars.
G1254656 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network