G1254886



Basic Information


Item Value
gene id G1254886
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 8149793 ~ 8150016 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1433547
aaggttcaccttccaacaggacaacgaccctaagcacacagcaaagacaacgcaggagtggcttcgggacaagtctctgaatgtccttgagtggcccagccagagcctggacttgaacccgatcgaacatctctggacagacctgaaaatagctgtgcagtgacgctcctcattcaacctgacagagcttgagaggatctgcagagaagaatggaagaaacttc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1433547 True 224 lncRNA 0.51 1 8149793 8150016
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490897 LOC106590637 coding upstream 55374 7899106 ~ 8094419 (+)
LOC110490896 NA coding upstream 283715 7863667 ~ 7866078 (+)
LOC110489541 arhgap29 coding upstream 1010230 7110207 ~ 7139563 (+)
LOC110489539 LOC106590649 coding upstream 1063905 7075115 ~ 7085888 (+)
LOC110490889 LOC106578491 coding upstream 1112034 7008276 ~ 7037759 (+)
LOC110489552 LOC106590631 coding downstream 291643 8441659 ~ 8453058 (+)
LOC110489555 LOC106590626 coding downstream 480337 8630353 ~ 8649744 (+)
LOC110489556 LOC106590625 coding downstream 519065 8669081 ~ 8672326 (+)
LOC110490900 dok6 coding downstream 673500 8823516 ~ 8956345 (+)
LOC110489557 LOC106590621 coding downstream 900528 9050544 ~ 9061028 (+)
G1254877 NA non-coding upstream 37638 8111900 ~ 8112155 (+)
G1254864 NA non-coding upstream 49813 8099762 ~ 8099980 (+)
G1254637 NA non-coding upstream 54102 8095181 ~ 8095691 (+)
G1254751 NA non-coding upstream 70133 8079460 ~ 8079660 (+)
G1254890 NA non-coding downstream 1170 8151186 ~ 8153429 (+)
G1254906 NA non-coding downstream 18459 8168475 ~ 8168685 (+)
G1254898 NA non-coding downstream 34702 8184718 ~ 8185844 (+)
G1254897 LOC100286462 non-coding downstream 40775 8190791 ~ 8214003 (+)
G1254916 NA non-coding downstream 49895 8199911 ~ 8200214 (+)
G1253720 LOC106590648 other upstream 1060758 7086331 ~ 7089035 (+)
alg14 alg14 other upstream 1148380 6997759 ~ 7002064 (+)
G1253703 LOC106590651 other upstream 1181377 6964482 ~ 6968416 (+)
LOC110490886 LOC106590655 other upstream 1821719 6242892 ~ 6328082 (+)
G1255589 NA other downstream 869229 9019245 ~ 9019731 (+)
G1257500 NA other downstream 2984828 11134844 ~ 11135414 (+)
G1257551 NA other downstream 3101911 11251927 ~ 11269539 (+)
LOC110489585 dap1 other downstream 3291332 11441274 ~ 11461528 (+)

Expression


G1254886 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1254886 Expression in each Bioproject

Bar chart with 21 bars.
G1254886 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network