G1259687



Basic Information


Item Value
gene id G1259687
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 13138038 ~ 13138274 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1439128
gtcaggtactgtgtctactgtcaggtactgtgtctactgtcaggtaccgtgtctactgtcaggtaccgtgtctactgtcaggtctactgtcaggtactgtgtctactgtcaggtactgtgtctactgtcaggtctactgtcaggtaccatttctactgtcaggtctactgtcaggtactgtgtctactgtcaggtaccgtgtctactgtcaggtctactgtcaggtactgtttctac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1439128 True 237 lncRNA 0.49 1 13138038 13138274

Neighbor


gene id symbol gene type direction distance location
LOC118938943 NA coding downstream 353959 12720801 ~ 12784079 (-)
LOC110489587 NA coding downstream 368247 12762412 ~ 12769791 (-)
LOC110489593 LOC106590549 coding downstream 604595 12507315 ~ 12533443 (-)
LOC118938787 NA coding downstream 1108622 12025555 ~ 12029416 (-)
LOC110489583 LOC106590573 coding downstream 1580567 11539629 ~ 11557471 (-)
LOC110489601 LOC106590561 coding upstream 14100 13152176 ~ 13163864 (-)
LOC110489602 LOC106590560 coding upstream 32074 13170348 ~ 13176530 (-)
LOC110490823 NA coding upstream 57451 13195725 ~ 13201088 (-)
LOC110490912 spag6 coding upstream 64931 13203205 ~ 13213651 (-)
LOC110489603 bmi1a coding upstream 81077 13219351 ~ 13227413 (-)
G1259680 NA non-coding downstream 15489 13117652 ~ 13122549 (-)
G1259648 NA non-coding downstream 22767 13060610 ~ 13115271 (-)
G1259677 NA non-coding downstream 26312 13110331 ~ 13111726 (-)
G1259667 NA non-coding downstream 44907 13092642 ~ 13093131 (-)
G1259643 NA non-coding downstream 57913 13055912 ~ 13080125 (-)
G1259709 NA non-coding upstream 54287 13192561 ~ 13192782 (-)
G1259721 NA non-coding upstream 95419 13233693 ~ 13234203 (-)
LOC110489604 mllt10 non-coding upstream 150454 13288725 ~ 13369504 (-)
G1260164 NA non-coding upstream 153137 13291411 ~ 13292149 (-)
G1257642 NA other downstream 2319127 10818443 ~ 10818911 (-)
LOC110489570 LOC106590600 other downstream 2842048 10256343 ~ 10296042 (-)
G1256654 NA other downstream 3263296 9873519 ~ 9874742 (-)
G1256146 NA other downstream 3659220 9477813 ~ 9478818 (-)
G1260199 NA other upstream 248115 13386389 ~ 13387587 (-)
G1260226 LOC106590529 other upstream 324591 13462865 ~ 13505161 (-)
G1260265 NA other upstream 398796 13537070 ~ 13538208 (-)
msl2b LOC106590518 other upstream 569739 13708013 ~ 13716136 (-)

Expression


G1259687 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1259687 Expression in each Bioproject

Bar chart with 6 bars.
G1259687 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network