G1259709



Basic Information


Item Value
gene id G1259709
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 13192561 ~ 13192782 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1439151
ggtgtgatactaaccttattaaaacatataggactatgggctaggctacatgaggtgtgatactaaccttattaaaacatatagacctacgggctaggctacatgaggtgtgatactaaccttattaaaacatataggactatgggctaggctacatgaggtgtgatactaaccttattaaaacatacaggactatgggctaggctacatgaggtgtgatac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1439151 True 222 lncRNA 0.39 1 13192561 13192782

Neighbor


gene id symbol gene type direction distance location
LOC110489602 LOC106590560 coding downstream 16031 13170348 ~ 13176530 (-)
LOC110489601 LOC106590561 coding downstream 28697 13152176 ~ 13163864 (-)
LOC118938943 NA coding downstream 408482 12720801 ~ 12784079 (-)
LOC110489587 NA coding downstream 422770 12762412 ~ 12769791 (-)
LOC110489593 LOC106590549 coding downstream 659118 12507315 ~ 12533443 (-)
LOC110490823 NA coding upstream 2943 13195725 ~ 13201088 (-)
LOC110490912 spag6 coding upstream 10423 13203205 ~ 13213651 (-)
LOC110489603 bmi1a coding upstream 26569 13219351 ~ 13227413 (-)
commd3 comd3 coding upstream 35340 13228122 ~ 13232921 (-)
LOC110489604 mllt10 coding upstream 95943 13288725 ~ 13369504 (-)
G1259687 NA non-coding downstream 54287 13138038 ~ 13138274 (-)
G1259680 NA non-coding downstream 70012 13117652 ~ 13122549 (-)
G1259648 NA non-coding downstream 77290 13060610 ~ 13115271 (-)
G1259721 NA non-coding upstream 40911 13233693 ~ 13234203 (-)
G1260164 NA non-coding upstream 98629 13291411 ~ 13292149 (-)
G1260154 NA non-coding upstream 103723 13296505 ~ 13297190 (-)
G1260192 NA non-coding upstream 178413 13371195 ~ 13414889 (-)
G1257642 NA other downstream 2373650 10818443 ~ 10818911 (-)
LOC110489570 LOC106590600 other downstream 2896571 10256343 ~ 10296042 (-)
G1256654 NA other downstream 3317819 9873519 ~ 9874742 (-)
G1256146 NA other downstream 3713743 9477813 ~ 9478818 (-)
G1260199 NA other upstream 193607 13386389 ~ 13387587 (-)
G1260226 LOC106590529 other upstream 270083 13462865 ~ 13505161 (-)
G1260265 NA other upstream 344288 13537070 ~ 13538208 (-)
msl2b LOC106590518 other upstream 515231 13708013 ~ 13716136 (-)

Expression


G1259709 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1259709 Expression in each Bioproject

Bar chart with 11 bars.
G1259709 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network