G1259731



Basic Information


Item Value
gene id G1259731
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 13246693 ~ 13247027 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1439180
CTGTTATTCTGTTACAAGCCAGACCATGATGCCTGATAGCTGCACCGTGGTTCTATCTGTTATTCTGTTACAAGCCAGACCATGATGCCTGATAGCAGCACCGTGGTTCTATCTGTTATTCTGTTACAAGCCAGACCATGATGCCTGATAGCTGCACCATGATTCTATCTGTTATTCTGTTACAAGCCAGACCATGATGCCTGATAGCTGCACCGTGGTTCTATCTGTTATTCTGTTACAAACCAGACCATGATGCCTGATAGCTGCACCGTGGTTCTATCTGTTATTCTGTTACAAGCCAGACCATGATGCCTGATAGCTGCACCGTGGTTCTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1439180 True 335 lncRNA 0.46 1 13246693 13247027

Neighbor


gene id symbol gene type direction distance location
LOC110489600 LOC106590541 coding upstream 102670 13140028 ~ 13144023 (+)
LOC110515947 LOC106578389 coding upstream 124142 12835920 ~ 13122551 (+)
sec61g NA coding upstream 525952 12718578 ~ 12720741 (+)
LOC110489589 LOC106590556 coding upstream 576965 12645767 ~ 12669728 (+)
LOC110489591 LOC106592044 coding upstream 607137 12562131 ~ 12639556 (+)
LOC110489606 skida1 coding downstream 127054 13374081 ~ 13380357 (+)
armc3 armc3 coding downstream 212182 13459209 ~ 13480871 (+)
LOC100135934 LOC106590529 coding downstream 249308 13496335 ~ 13505165 (+)
LOC110489613 LOC106590529 coding downstream 267772 13514799 ~ 13517938 (+)
si:ch211-230g15.5 LOC106590521 coding downstream 285575 13532602 ~ 13551953 (+)
G1259478 bmi1a non-coding upstream 26870 13218363 ~ 13219823 (+)
G1259469 NA non-coding upstream 70834 13165171 ~ 13175859 (+)
G1259465 ezh2 non-coding upstream 85215 13158773 ~ 13161478 (+)
G1259460 NA non-coding upstream 96335 13148539 ~ 13150358 (+)
G1259455 NA non-coding upstream 108259 13138125 ~ 13138434 (+)
G1259738 NA non-coding downstream 12009 13259036 ~ 13259439 (+)
G1259783 NA non-coding downstream 154624 13401651 ~ 13405169 (+)
G1259784 LOC106578380 non-coding downstream 159255 13406282 ~ 13407325 (+)
G1259831 NA non-coding downstream 235655 13482682 ~ 13492227 (+)
G1259481 NA other upstream 62126 13184293 ~ 13184567 (+)
G1258375 NA other upstream 1341175 11905086 ~ 11905518 (+)
G1257945 NA other upstream 1783205 11461992 ~ 11463488 (+)
LOC110490824 LOC106590516 other downstream 499640 13746336 ~ 13758266 (+)
G1260013 NA other downstream 622288 13869315 ~ 13870230 (+)
G1260074 NA other downstream 714474 13961501 ~ 13961816 (+)
LOC110489635 LOC106590481 other downstream 963338 14186442 ~ 14217437 (+)

Expression


G1259731 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1259731 Expression in each Bioproject

Bar chart with 8 bars.
G1259731 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network