G1262568



Basic Information


Item Value
gene id G1262568
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 16036291 ~ 16036458 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1442668
TTCCTTTGCTGACGCTGCAGTTTGGGTTACCTTTCGTTTTTCTACAAGTGAACAACATCATGGCTCACTTTCAAGAGTGCAGTATCACCCTACCTTGGGTGAAAAACAGATTGATTGCAGGTACCAGACAAAGGAACAAACAGGTCTAGTATTTTGTTCAATATCACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1442668 True 168 lncRNA 0.41 1 16036291 16036458

Neighbor


gene id symbol gene type direction distance location
LOC110490929 LOC106590401 coding downstream 1008 15938237 ~ 16035283 (-)
LOC110489696 cops5 coding downstream 112486 15918395 ~ 15923805 (-)
LOC110489694 LOC106590412 coding downstream 131949 15900480 ~ 15904342 (-)
LOC110489693 NA coding downstream 138281 15894467 ~ 15898010 (-)
LOC110489690 LOC106590399 coding downstream 191092 15821701 ~ 15845199 (-)
LOC110490931 cpa6 coding upstream 2184 16038626 ~ 16079595 (-)
LOC110489700 LOC106590414 coding upstream 88910 16125368 ~ 16128702 (-)
LOC110489698 LOC106590406 coding upstream 92544 16129002 ~ 16144964 (-)
LOC110489701 LOC106590404 coding upstream 124896 16161354 ~ 16177141 (-)
shrprbck1r LOC106590417 coding upstream 170334 16206792 ~ 16219467 (-)
G1262574 NA non-coding downstream 72108 15961312 ~ 15964183 (-)
G1262573 NA non-coding downstream 79397 15956619 ~ 15956894 (-)
G1262563 NA non-coding downstream 101277 15934701 ~ 15935014 (-)
G1262521 NA non-coding downstream 187106 15848415 ~ 15849185 (-)
G1262569 NA non-coding upstream 1391 16037849 ~ 16038167 (-)
G1262624 NA non-coding upstream 6740 16043198 ~ 16043525 (-)
G1262650 NA non-coding upstream 49179 16085637 ~ 16085880 (-)
G1262694 NA non-coding upstream 164072 16200530 ~ 16200789 (-)
G1262503 NA other downstream 228674 15806250 ~ 15807617 (-)
G1261796 NA other downstream 530093 15505698 ~ 15506198 (-)
G1261602 NA other downstream 846475 15189546 ~ 15189816 (-)
G1262745 NA other upstream 239551 16276009 ~ 16276552 (-)
G1263444 NA other upstream 609186 16645644 ~ 16646417 (-)
G1264199 LOC106590429 other upstream 1425370 17461828 ~ 17462977 (-)
G1265249 NA other upstream 2147333 18183791 ~ 18184123 (-)
G1265456 LOC106590371 other upstream 2540081 18576539 ~ 18580163 (-)

Expression


G1262568 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1262568 Expression in each Bioproject

Bar chart with 10 bars.
G1262568 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network