G1264961



Basic Information


Item Value
gene id G1264961
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 18193118 ~ 18193395 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1445255
gtattcaattgaccaccagagacatttttcaaaggacaaaggactcggtttggcaacacggccttccatctaccaccaacctaccgaagcgcagctcagagtaaatatttattgcattttccttttccaaatgggcggtaatttagaatgcataagatactgtatttacgatagcacagcttctccctttgtccctcagtcttcccgctctttcactctaacccagccccttttcttttgagtaaccagctgtcatatctgttccgcccgctagggac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1445255 True 278 lncRNA 0.45 1 18193118 18193395

Neighbor


gene id symbol gene type direction distance location
dnah5l LOC106590358 coding upstream 21757 18101687 ~ 18171361 (+)
LOC110489724 LOC106590359 coding upstream 100987 17989845 ~ 18092131 (+)
LOC110489719 LOC106590432 coding upstream 551310 17537295 ~ 17641808 (+)
LOC110490933 LOC106590429 coding upstream 720156 17244157 ~ 17472962 (+)
LOC118938946 NA coding upstream 962558 17228750 ~ 17230560 (+)
LOC110489727 LOC106590362 coding downstream 34434 18227829 ~ 18275594 (+)
LOC110489731 LOC106590368 coding downstream 112819 18306214 ~ 18325293 (+)
scn5lab LOC106590371 coding downstream 196762 18390157 ~ 18580116 (+)
LOC110489736 LOC106590352 coding downstream 657236 18850631 ~ 18855321 (+)
LOC110489737 LOC106590377 coding downstream 666302 18859697 ~ 18866106 (+)
G1264958 NA non-coding upstream 2069 18190843 ~ 18191049 (+)
G1264857 NA non-coding upstream 27629 18164931 ~ 18165489 (+)
G1264873 NA non-coding upstream 55012 18137890 ~ 18138106 (+)
G1264862 NA non-coding upstream 81227 18110742 ~ 18111891 (+)
G1264616 NA non-coding upstream 259992 17932890 ~ 17933126 (+)
G1264977 NA non-coding downstream 24941 18218336 ~ 18218543 (+)
G1264985 NA non-coding downstream 85355 18278750 ~ 18279651 (+)
G1265027 NA non-coding downstream 176377 18369772 ~ 18422663 (+)
G1265070 NA non-coding downstream 240234 18433629 ~ 18436883 (+)
mcmdc2 mcmdc2 other upstream 2298954 15885437 ~ 15895996 (+)
G1261980 NA other upstream 2456701 15735930 ~ 15736417 (+)
LOC110489686 LOC106590396 other upstream 2486579 15696896 ~ 15706601 (+)
LOC110489660 pan3 other upstream 2998173 15166247 ~ 15194945 (+)
G1260946 LOC106590444 other upstream 3171065 15020992 ~ 15022053 (+)
epb41l3a LOC106590342 other downstream 1480718 19598284 ~ 19680110 (+)
G1267949 pck2 other downstream 2646900 20840295 ~ 20841398 (+)
slc12a7b LOC106590280 other downstream 3592826 21729755 ~ 21794253 (+)
LOC110489812 rdh12 other downstream 4939464 23132828 ~ 23146739 (+)

Expression


G1264961 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1264961 Expression in each Bioproject

Bar chart with 19 bars.
G1264961 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network