G1271047



Basic Information


Item Value
gene id G1271047
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 22801315 ~ 22805575 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1452053
cattgtgacgtatttgtaggcatatcattggaagattgaccataagagactacattttccaagtgtccgcctggtgtcctgcgtcgaattcggtgcgcaattgccagctgcttctactttaccatttgattcaggggagaaagcatgtgtccaagaacgatgtatcaatgaagagatatgtgaaaaacaccttgatgattgattctaaacaacgtttgccatgttttcagtcgatattatggagttaatttggaaaaaagttcgcgttttgaggactgaattttcggggtttttttggtagccaaatgtgatgtataaaacggagctatttctaatacacaaggaatctttttggaaaaactgagcatctgctatctaactgagagtatcctcattgaaaacatcagaagttcttcaaaggtaaattattttatttgaaggcttttatgtttttgttgaaatgttgcgtgctggatgctaatgctaatgctaacgctaaatcctttgtttgctagctactgttacacaaattattgttttcctatggttgagaagcatattttgaaaatctgagatgacagttttgtttacaaaaggctaagcttgcgagatggcatatttatttcatttcatttgcgattttcatgaatagttaacgttgcgttatgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1452053 True 669 lncRNA 0.36 2 22801315 22805575

Neighbor


gene id symbol gene type direction distance location
LOC118938910 NA coding downstream 4336 22795564 ~ 22796979 (-)
LOC110489807 LOC106590288 coding downstream 124929 22644341 ~ 22676386 (-)
LOC110489790 LOC106590241 coding downstream 354620 22367531 ~ 22446695 (-)
LOC110489802 LOC106590287 coding downstream 441809 22312796 ~ 22359506 (-)
LOC110489804 LOC106590285 coding downstream 490044 22215471 ~ 22311271 (-)
LOC110490829 LOC106590245 coding upstream 92537 22898112 ~ 22899241 (-)
si:dkey-225n22.4 LOC106590290 coding upstream 102341 22907916 ~ 22955764 (-)
LOC110489811 LOC106590294 coding upstream 255109 23060684 ~ 23122826 (-)
LOC110489813 LOC106590295 coding upstream 341294 23146869 ~ 23156952 (-)
pks1 LOC106590299 coding upstream 406542 23212117 ~ 23221568 (-)
G1270184 NA non-coding downstream 215728 22585343 ~ 22585587 (-)
G1270181 NA non-coding downstream 217480 22583528 ~ 22583835 (-)
G1270139 NA non-coding downstream 250083 22550994 ~ 22551232 (-)
G1270119 NA non-coding downstream 255844 22545265 ~ 22545471 (-)
G1270105 NA non-coding downstream 263102 22537977 ~ 22538213 (-)
G1271074 NA non-coding upstream 27630 22833205 ~ 22834370 (-)
G1271082 NA non-coding upstream 34911 22840486 ~ 22840912 (-)
G1271085 NA non-coding upstream 38023 22843598 ~ 22843829 (-)
G1271201 NA non-coding upstream 217730 23023305 ~ 23026796 (-)
G1271285 NA non-coding upstream 370295 23175870 ~ 23176099 (-)
G1269265 NA other downstream 997963 21802687 ~ 21803352 (-)
G1268555 LOC106590243 other downstream 1841226 20958372 ~ 20960089 (-)
G1267452 NA other downstream 2510642 20290350 ~ 20290673 (-)
G1267414 NA other downstream 2532827 20267966 ~ 20268488 (-)
G1266708 LOC106590345 other downstream 3347545 19435018 ~ 19453770 (-)
G1271421 NA other upstream 907780 23713355 ~ 23728939 (-)
G1274532 LOC106590196 other upstream 3240673 26046058 ~ 26048599 (-)
G1275015 NA other upstream 3705950 26511525 ~ 26512075 (-)
G1275016 LOC106590191 other upstream 3749393 26554968 ~ 26562033 (-)
LOC110489888 gli3 other upstream 3764703 26566351 ~ 26694581 (-)

Expression


G1271047 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1271047 Expression in each Bioproject

Bar chart with 16 bars.
G1271047 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network