G1270390



Basic Information


Item Value
gene id G1270390
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 22861587 ~ 22861852 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1451318
acaaataatctttcaggaaaaactgaacatttgctatctgagagtctcctcattgaaaacatctgaagttcttcaaaggtaaatgatttttttgaatgcttttctgtttttttgtgtaaatgttgccagctgaatgctaatgctaaatgctacgttagccatcaatactgttacacaaatgcttgttttgcaatggttgagaagcatattttgaaaatctgagatgacagtgttgttaacaaaaggctaagcttgagaggtagcat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1451318 True 266 lncRNA 0.34 1 22861587 22861852

Neighbor


gene id symbol gene type direction distance location
lancl2 lancl2 coding upstream 646137 22152830 ~ 22215450 (+)
tgfbr1b LOC106590284 coding upstream 736217 22061784 ~ 22125370 (+)
LOC110489805 LOC106590283 coding upstream 807527 21996818 ~ 22054060 (+)
LOC110489791 LOC106590282 coding upstream 869597 21909632 ~ 21991990 (+)
si:ch211-276f18.2 gfod1 coding upstream 1017518 21804152 ~ 21844069 (+)
LOC110489808 LOC106590291 coding downstream 100960 22962812 ~ 23028566 (+)
LOC100136251 LOC100136251 coding downstream 167091 23028943 ~ 23036510 (+)
pigm pigm coding downstream 176328 23038180 ~ 23044436 (+)
LOC110489812 rdh12 coding downstream 270976 23132828 ~ 23146739 (+)
LOC110489816 LOC106590246 coding downstream 296105 23157957 ~ 23162305 (+)
G1270389 NA non-coding upstream 316 22860947 ~ 22861271 (+)
G1270386 NA non-coding upstream 3871 22857235 ~ 22857716 (+)
G1270385 NA non-coding upstream 6591 22854767 ~ 22854996 (+)
G1270359 NA non-coding upstream 38577 22822661 ~ 22823010 (+)
G1270180 NA non-coding upstream 277815 22583564 ~ 22583772 (+)
G1270414 NA non-coding downstream 38653 22900505 ~ 22900886 (+)
G1270416 NA non-coding downstream 41430 22903282 ~ 22903570 (+)
G1270489 NA non-coding downstream 187912 23049764 ~ 23049975 (+)
G1270541 NA non-coding downstream 261102 23122954 ~ 23127564 (+)
slc12a7b LOC106590280 other upstream 1067334 21729755 ~ 21794253 (+)
G1267949 pck2 other upstream 2020189 20840295 ~ 20841398 (+)
epb41l3a LOC106590342 other upstream 3181482 19598284 ~ 19680110 (+)
LOC110489737 LOC106590377 other upstream 3999076 18859697 ~ 18866106 (+)
mcmdc2 mcmdc2 other upstream 6967423 15885437 ~ 15895996 (+)
G1270643 NA other downstream 515456 23377308 ~ 23377560 (+)
G1270652 NA other downstream 544808 23406660 ~ 23408002 (+)
G1270669 psme2 other downstream 583986 23445838 ~ 23451494 (+)
LOC110489839 LOC106590236 other downstream 804619 23666471 ~ 23836438 (+)

Expression


G1270390 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1270390 Expression in each Bioproject

Bar chart with 8 bars.
G1270390 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network