G1271287



Basic Information


Item Value
gene id G1271287
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 23177992 ~ 23178191 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1452306
ATTTCAATGAGAAACAGCCACCTCACTCGGGCAAAATGCAAACCTCTATCGATGGCATGAAGGCTTTTCTAGAGAAAAATTATAAACGGATGACCCACATTGAAAGAAAAATGAGGAACATGACGAAAAGCTAATACAACAAGATCAAGCTATTAACTACCTGATGGGTCAGGTAGAGGAATTACAAAATAAGGGAGACT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1452306 True 200 lncRNA 0.39 1 23177992 23178191

Neighbor


gene id symbol gene type direction distance location
LOC110489813 LOC106590295 coding downstream 21040 23146869 ~ 23156952 (-)
LOC110489811 LOC106590294 coding downstream 55166 23060684 ~ 23122826 (-)
si:dkey-225n22.4 LOC106590290 coding downstream 222228 22907916 ~ 22955764 (-)
LOC110490829 LOC106590245 coding downstream 278751 22898112 ~ 22899241 (-)
LOC118938910 NA coding downstream 381013 22795564 ~ 22796979 (-)
pks1 LOC106590299 coding upstream 33926 23212117 ~ 23221568 (-)
LOC110489819 LOC106590300 coding upstream 43501 23221692 ~ 23242314 (-)
acbd5a acbd5 coding upstream 75695 23253886 ~ 23275145 (-)
LOC118938792 NA coding upstream 157281 23335472 ~ 23337723 (-)
LOC110489827 NA coding upstream 159691 23337882 ~ 23339790 (-)
G1271285 NA non-coding downstream 1893 23175870 ~ 23176099 (-)
G1271201 NA non-coding downstream 151196 23023305 ~ 23026796 (-)
G1271085 NA non-coding downstream 334163 22843598 ~ 22843829 (-)
G1271082 NA non-coding downstream 337080 22840486 ~ 22840912 (-)
G1271074 NA non-coding downstream 343622 22833205 ~ 22834370 (-)
G1271297 LOC106590247 non-coding upstream 18261 23196452 ~ 23203364 (-)
G1271299 NA non-coding upstream 26396 23204587 ~ 23204788 (-)
G1271370 NA non-coding upstream 192257 23370448 ~ 23370759 (-)
G1271376 NA non-coding upstream 226696 23404887 ~ 23407463 (-)
G1271556 NA non-coding upstream 558638 23736829 ~ 23737030 (-)
G1269265 NA other downstream 1374640 21802687 ~ 21803352 (-)
G1268555 LOC106590243 other downstream 2217903 20958372 ~ 20960089 (-)
G1267452 NA other downstream 2887319 20290350 ~ 20290673 (-)
G1267414 NA other downstream 2909504 20267966 ~ 20268488 (-)
G1266708 LOC106590345 other downstream 3724222 19435018 ~ 19453770 (-)
G1271421 NA other upstream 535164 23713355 ~ 23728939 (-)
G1274532 LOC106590196 other upstream 2868057 26046058 ~ 26048599 (-)
G1275015 NA other upstream 3333334 26511525 ~ 26512075 (-)
G1275016 LOC106590191 other upstream 3376777 26554968 ~ 26562033 (-)
LOC110489888 gli3 other upstream 3392087 26566351 ~ 26694581 (-)

Expression


G1271287 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1271287 Expression in each Bioproject

Bar chart with 6 bars.
G1271287 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network