G1270643



Basic Information


Item Value
gene id G1270643
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 23377308 ~ 23377560 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1451615
CCATCCCAGGGAAGCCGCAGTAAGGGTTGTATGGCATGGGCCACTGATAGGGTAGAGCAGAGGGGTAAAGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGAATGGCTGGGAAGGGTGTATGTAGAAGAATGGTCTGCTGTGCTGGATGTGGTGATGGGGCTGCTGGTG

Function


NR:

description
PREDICTED: uncharacterized protein LOC106590307 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1451615 True 253 TUCP 0.58 1 23377308 23377560

Neighbor


gene id symbol gene type direction distance location
LOC110489828 LOC106590304 coding upstream 8496 23350408 ~ 23368812 (+)
LOC110489823 LOC106590302 coding upstream 35213 23275513 ~ 23342095 (+)
mastl LOC106590301 coding upstream 123522 23248095 ~ 23253786 (+)
ptchd3a LOC106590298 coding upstream 165411 23204933 ~ 23211897 (+)
LOC110489817 LOC106590247 coding upstream 173949 23189104 ~ 23203359 (+)
LOC110510445 LOC106590311 coding downstream 9976 23387536 ~ 23399121 (+)
LOC110489836 lsm5 coding downstream 62282 23439842 ~ 23445587 (+)
prex2 prex2 coding downstream 80548 23458108 ~ 23658840 (+)
LOC110489839 LOC106590236 coding downstream 289109 23666471 ~ 23836438 (+)
gig2e NA coding downstream 320620 23698180 ~ 23730175 (+)
G1270640 NA non-coding upstream 1678 23375395 ~ 23375630 (+)
G1270639 LOC106590307 non-coding upstream 2035 23374790 ~ 23375273 (+)
G1270563 NA non-coding upstream 116500 23260257 ~ 23260808 (+)
G1270565 LOC106590299 non-coding upstream 158843 23212121 ~ 23218465 (+)
G1270595 NA non-coding upstream 189354 23187703 ~ 23187954 (+)
G1270647 LOC106590309 non-coding downstream 7194 23384754 ~ 23385062 (+)
G1270651 NA non-coding downstream 25519 23403079 ~ 23405314 (+)
G1270669 psme2 non-coding downstream 68278 23445838 ~ 23451494 (+)
LOC110489812 rdh12 other upstream 240587 23132828 ~ 23146739 (+)
slc12a7b LOC106590280 other upstream 1583055 21729755 ~ 21794253 (+)
G1267949 pck2 other upstream 2535910 20840295 ~ 20841398 (+)
epb41l3a LOC106590342 other upstream 3697203 19598284 ~ 19680110 (+)
LOC110489737 LOC106590377 other upstream 4514797 18859697 ~ 18866106 (+)
G1270652 NA other downstream 29100 23406660 ~ 23408002 (+)
G1271852 LOC106584099 other downstream 868863 24246423 ~ 24250283 (+)
G1272220 LOC106590226 other downstream 1010852 24388412 ~ 24403661 (+)

Expression


G1270643 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1270643 Expression in each Bioproject

Bar chart with 5 bars.
G1270643 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network