G1272295


Basic Information

Item Value
gene id G1272295
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 24511138 ~ 24511402 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1453387
catattctttatccccttacactgtgtataagacagtagttttggaattgttagttagattacttgttggttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacaaataacatttgatttgatttgatttgatttgaagtgcatcgatgacatcatccccacagtgaccgtatgtacataccacaaccagaagccatggattacaggcaacatccatac

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1453387 True 265 lncRNA 0.38 1 24511138 24511402

Neighbor

gene id symbol gene type direction distance location
nle1 nle1 coding upstream 281428 24213666 ~ 24229710 (+)
si:ch211-37e10.2 LOC106590232 coding upstream 318225 24186466 ~ 24192913 (+)
sulf1 sulf1 coding upstream 483337 23950432 ~ 24027801 (+)
LOC118938911 NA coding upstream 606746 23857413 ~ 23904392 (+)
gig2e NA coding upstream 780963 23698180 ~ 23730175 (+)
prtfdc1a LOC106590221 coding downstream 93100 24604502 ~ 24618190 (+)
LOC110489855 arhgap21 coding downstream 114067 24625469 ~ 24731493 (+)
chchd7 chch7 coding downstream 248450 24759852 ~ 24762965 (+)
LOC110489862 fam110b coding downstream 315206 24826608 ~ 24829935 (+)
LOC110489863 sdcbp coding downstream 325205 24836607 ~ 24840963 (+)
G1272294 NA non-coding upstream 38 24510873 ~ 24511100 (+)
G1272293 NA non-coding upstream 1646 24509267 ~ 24509492 (+)
G1272287 NA non-coding upstream 8410 24502503 ~ 24502728 (+)
G1272278 gpr158 non-coding upstream 18885 24491832 ~ 24492253 (+)
G1272274 NA non-coding upstream 27422 24483341 ~ 24483716 (+)
G1272296 NA non-coding downstream 1749 24513151 ~ 24513539 (+)
G1272304 gpr158 non-coding downstream 13058 24524460 ~ 24524759 (+)
G1272317 NA non-coding downstream 36340 24547742 ~ 24547971 (+)
G1272502 NA non-coding downstream 79496 24590898 ~ 24591182 (+)
G1272573 NA non-coding downstream 230477 24741879 ~ 24787896 (+)
G1272220 LOC106590226 other upstream 107477 24388412 ~ 24403661 (+)
G1271852 LOC106584099 other upstream 260855 24246423 ~ 24250283 (+)
LOC110489839 LOC106590236 other upstream 815957 23666471 ~ 23836438 (+)
G1270669 psme2 other upstream 1060665 23445838 ~ 23451494 (+)
G1270652 NA other upstream 1103136 23406660 ~ 23408002 (+)
LOC110489866 tmem241 other downstream 360450 24869606 ~ 24876724 (+)
G1272672 LOC106590208 other downstream 448530 24959932 ~ 25027501 (+)
rbis cssa29h8orf59 other downstream 457007 24968304 ~ 24976522 (+)

Expression


Co-expression Network