G1272819



Basic Information


Item Value
gene id G1272819
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 25113016 ~ 25113243 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1453965
TTTATATTTAAACCAAATTCTACTACGGTATGTCTTCTCCTTTGAATCACAGCACAGGAAACTGAATTTTTATGCCAATGAATTACATTAGGAGAAACTACACATATGGAAACGTAATGTCAAATTGACCTCCAAAGATAATCCCCCATTGTCTGGTCATCAAGAAACCATTCAAAATCCAATCTTAATAAAAGTAGCCTTACTACAGTCTATGAGCTAAATTCAACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1453965 True 228 lncRNA 0.34 1 25113016 25113243

Neighbor


gene id symbol gene type direction distance location
rbis cssa29h8orf59 coding upstream 136494 24968304 ~ 24976522 (+)
LOC110489866 tmem241 coding upstream 236292 24869606 ~ 24876724 (+)
LOC110489863 sdcbp coding upstream 272053 24836607 ~ 24840963 (+)
LOC110489862 fam110b coding upstream 283081 24826608 ~ 24829935 (+)
chchd7 chch7 coding upstream 350053 24759852 ~ 24762965 (+)
zgc:111976 LOC106590202 coding downstream 539495 25652738 ~ 25662668 (+)
LOC110489875 LOC106590201 coding downstream 552480 25665723 ~ 25703391 (+)
LOC118938912 NA coding downstream 693431 25806674 ~ 25820021 (+)
LOC118938913 NA coding downstream 738577 25851820 ~ 25853297 (+)
LOC110489881 LOC106590196 coding downstream 821934 25935177 ~ 26048644 (+)
G1272813 NA non-coding upstream 6144 25106560 ~ 25106872 (+)
G1272812 NA non-coding upstream 6975 25105755 ~ 25106041 (+)
G1272672 LOC106590208 non-coding upstream 85515 24959932 ~ 25027501 (+)
G1272702 NA non-coding upstream 193222 24919563 ~ 24919794 (+)
G1272701 NA non-coding upstream 193615 24919182 ~ 24919401 (+)
G1272835 NA non-coding downstream 21250 25134493 ~ 25134699 (+)
G1272846 NA non-coding downstream 34313 25147556 ~ 25147786 (+)
G1272851 NA non-coding downstream 42790 25156033 ~ 25156923 (+)
G1273235 NA non-coding downstream 63853 25177096 ~ 25177316 (+)
G1273264 NA non-coding downstream 80239 25193482 ~ 25193800 (+)
G1272573 NA other upstream 369211 24741879 ~ 24787896 (+)
G1274765 NA other downstream 1251035 26364278 ~ 26365146 (+)
G1274830 NA other downstream 1326768 26440011 ~ 26442387 (+)
kif9 kif9 other downstream 1847548 26960749 ~ 26974049 (+)
G1275572 NA other downstream 1988066 27101309 ~ 27102027 (+)
G1276288 NA other downstream 2740375 27853618 ~ 27854013 (+)

Expression


G1272819 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1272819 Expression in each Bioproject

Bar chart with 4 bars.
G1272819 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network