G1274765


Basic Information

Item Value
gene id G1274765
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 26364278 ~ 26365146 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1456051
gttctgctggtcattttgtcacttcatgtccagtaaaagccagagctcatcagtaagcggagggctactggtgagcgctactactcctgtctctccttcaagatcctgcactaccttgtcggtccatctacgctggaccggttcgtcagcttcctgcagtgccttaatagactctggggcggagggctgttttatggacaagacctgggctcgggaacatgacattcctctcagacagttaagggagtccacggccttgttcgccctggatggtagtcctctccccaggattcagcgtgagacgctacctttaaccctcactgtttctggtaatcatagcgaaaccatttcttttttaatttttcgttcaccttttacacctgttgttttgggccatccctggctagtttgtcataatccttccattaattggtctagtaattctatcctctcctggaacgtctcttgtcatgtgaaatgtttaatgtctgctgtccctcctgtttcctctgtctcttcttcacaggaggagcctggtgatttgacaggggtgccggaggaatatcacgatctgcgcacagtgttcagtcggtccagggccacctctcttcctccacaccggtcgtatgattgtagtattgatctccttccgggaaccactcccccccggggtagactatactctctgtcggctcccgaacgtaaggctctcgaagattatttgtctgtagctcttgccgccggtaccatagtcccctcctcctctcccgccggagcgggggttttttttgttaagaagaaggacgggtccctgcgcccctgcatagattatcgagggctgaatgacataacagtgaagaatcgttatc

Function

NR:

description
Retrotransposable element Tf2 protein type 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1456051 True 869 TUCP 0.51 1 26364278 26365146
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110489881 LOC106590196 coding upstream 315634 25935177 ~ 26048644 (+)
LOC118938913 NA coding upstream 510981 25851820 ~ 25853297 (+)
LOC118938912 NA coding upstream 544257 25806674 ~ 25820021 (+)
LOC110489875 LOC106590201 coding upstream 660887 25665723 ~ 25703391 (+)
zgc:111976 LOC106590202 coding upstream 701610 25652738 ~ 25662668 (+)
LOC110489887 LOC106590191 coding downstream 179549 26544695 ~ 26564656 (+)
LOC110489891 LOC106590187 coding downstream 391629 26756775 ~ 26759201 (+)
LOC110489893 LOC106590186 coding downstream 396794 26761940 ~ 26810579 (+)
topbp1 LOC106590185 coding downstream 445876 26811022 ~ 26849032 (+)
LOC110489896 LOC106590184 coding downstream 494973 26860119 ~ 26918648 (+)
G1274754 NA non-coding upstream 9110 26354875 ~ 26355168 (+)
G1274731 NA non-coding upstream 33892 26330185 ~ 26330386 (+)
G1274007 NA non-coding upstream 76271 26287761 ~ 26288007 (+)
G1274000 LOC100194703 non-coding upstream 86476 26277210 ~ 26277802 (+)
G1273990 NA non-coding upstream 96938 26266996 ~ 26267340 (+)
G1274767 NA non-coding downstream 1478 26366624 ~ 26367246 (+)
G1274769 NA non-coding downstream 3856 26369002 ~ 26369315 (+)
G1274787 NA non-coding downstream 19670 26384816 ~ 26385032 (+)
G1274795 NA non-coding downstream 27128 26392274 ~ 26392492 (+)
G1274800 NA non-coding downstream 31418 26396564 ~ 26396763 (+)
rbis cssa29h8orf59 other upstream 1389565 24968304 ~ 24976522 (+)
G1272672 LOC106590208 other upstream 1401237 24959932 ~ 25027501 (+)
LOC110489866 tmem241 other upstream 1487562 24869606 ~ 24876724 (+)
chchd7 chch7 other upstream 1601313 24759852 ~ 24762965 (+)
G1272573 NA other upstream 1620473 24741879 ~ 24787896 (+)
G1274830 NA other downstream 74865 26440011 ~ 26442387 (+)
kif9 kif9 other downstream 595645 26960749 ~ 26974049 (+)
G1275572 NA other downstream 736163 27101309 ~ 27102027 (+)
G1276288 NA other downstream 1488472 27853618 ~ 27854013 (+)
G1276733 NA other downstream 1825040 28190186 ~ 28256406 (+)

Expression

G1274765 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1274765 Expression in each Bioproject

Bar chart with 20 bars.
G1274765 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network