G1275154



Basic Information


Item Value
gene id G1275154
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 26725805 ~ 26726152 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1456457
GTCCAGTATCATTGGTCTGCTAACACATTGGCTCTGTCTGGTCAAATGATAAGGATATAGAAACTTTCCCGTGACCACTTCTTCTTTGGTCTTACTCTCAAGGACCTCATCTGTCACTGTAACAAGAATTAGAGAACATGAATCAGTACAAACAGTCTTTAATGACGTTTAGCTTTTTTTAATCTAAGACGAATGACACAACACAGTGATGCATAGAGAAGAAAGGTTAAATAGTTATTGTCTGGTTTCAATGGTGTGGATATGTGACATCTATGATTTACCTAGTCATTAAGTTACTCATATCCTCAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1456457 True 311 lncRNA 0.37 2 26725805 26726152

Neighbor


gene id symbol gene type direction distance location
LOC110489887 LOC106590191 coding upstream 161149 26544695 ~ 26564656 (+)
LOC110489881 LOC106590196 coding upstream 677161 25935177 ~ 26048644 (+)
LOC118938913 NA coding upstream 872508 25851820 ~ 25853297 (+)
LOC118938912 NA coding upstream 905784 25806674 ~ 25820021 (+)
LOC110489875 LOC106590201 coding upstream 1022414 25665723 ~ 25703391 (+)
LOC110489891 LOC106590187 coding downstream 30623 26756775 ~ 26759201 (+)
LOC110489893 LOC106590186 coding downstream 35788 26761940 ~ 26810579 (+)
topbp1 LOC106590185 coding downstream 84870 26811022 ~ 26849032 (+)
LOC110489896 LOC106590184 coding downstream 133967 26860119 ~ 26918648 (+)
LOC110489897 LOC100380682 coding downstream 197742 26923894 ~ 26928782 (+)
G1275147 NA non-coding upstream 9979 26715481 ~ 26715826 (+)
G1274926 gli3 non-coding upstream 99308 26601652 ~ 26626497 (+)
G1274907 gli3 non-coding upstream 157073 26566376 ~ 26568732 (+)
G1274899 NA non-coding upstream 188300 26537292 ~ 26537505 (+)
G1274894 NA non-coding upstream 194135 26531444 ~ 26531670 (+)
G1275160 NA non-coding downstream 4446 26730598 ~ 26731062 (+)
G1275243 NA non-coding downstream 185044 26911196 ~ 26911423 (+)
G1275251 NA non-coding downstream 197000 26923152 ~ 26923447 (+)
G1275257 NA non-coding downstream 208885 26935037 ~ 26935277 (+)
G1275272 NA non-coding downstream 249527 26975679 ~ 26982457 (+)
G1274830 NA other upstream 283418 26440011 ~ 26442387 (+)
G1274765 NA other upstream 360659 26364278 ~ 26365146 (+)
rbis cssa29h8orf59 other upstream 1751092 24968304 ~ 24976522 (+)
G1272672 LOC106590208 other upstream 1762764 24959932 ~ 25027501 (+)
LOC110489866 tmem241 other upstream 1849089 24869606 ~ 24876724 (+)
kif9 kif9 other downstream 234639 26960749 ~ 26974049 (+)
G1275572 NA other downstream 375157 27101309 ~ 27102027 (+)
G1276288 NA other downstream 1127466 27853618 ~ 27854013 (+)
G1276733 NA other downstream 1464034 28190186 ~ 28256406 (+)
G1277159 NA other downstream 1848164 28574316 ~ 28624218 (+)

Expression


G1275154 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1275154 Expression in each Bioproject

Bar chart with 3 bars.
G1275154 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network