G1275637



Basic Information


Item Value
gene id G1275637
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 27189834 ~ 27195235 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1456997
tcctgctttgtcttggctgtgtgcctagagtcattgacctgttggaaggtgaaccttcaccccagtctgaggtcctgagcgcactggagcaggttttcatcaaggatctctttgtactttgctcggttcatctttccctcgatcctgactattctcccagtccctgccactgaaaaacatccccacggcatgatgaagccaccaccatccttcaccgtaggaatggtgccaggtttcctccagacgtgaggcttggcattcaggccaaagagttcaatc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1456997 True 279 lncRNA 0.52 2 27189834 27195235
Loading

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-66 NA coding upstream 96271 27093489 ~ 27093563 (+)
kif9 kif9 coding upstream 215785 26960749 ~ 26974049 (+)
LOC110489897 LOC100380682 coding upstream 261052 26923894 ~ 26928782 (+)
LOC110489896 LOC106590184 coding upstream 271186 26860119 ~ 26918648 (+)
topbp1 LOC106590185 coding upstream 340802 26811022 ~ 26849032 (+)
LOC110489907 LOC106590173 coding downstream 137251 27332486 ~ 27350841 (+)
chpf2 LOC106590171 coding downstream 166568 27361803 ~ 27369326 (+)
asap1b LOC106590164 coding downstream 257045 27452280 ~ 27519315 (+)
fam49bb LOC106590167 coding downstream 328890 27524125 ~ 27563497 (+)
LOC110489920 LOC106590161 coding downstream 576382 27771617 ~ 27795387 (+)
G1275576 NA non-coding upstream 84342 27105283 ~ 27105492 (+)
G1275573 NA non-coding upstream 86717 27102837 ~ 27103117 (+)
G1275563 LOC106590178 non-coding upstream 99742 27079719 ~ 27090092 (+)
G1275272 NA non-coding upstream 207377 26975679 ~ 26982457 (+)
G1275257 NA non-coding upstream 254557 26935037 ~ 26935277 (+)
G1275642 NA non-coding downstream 8752 27203987 ~ 27263740 (+)
G1275629 NA non-coding downstream 11581 27206816 ~ 27231469 (+)
G1275682 NA non-coding downstream 67079 27262314 ~ 27285241 (+)
G1275724 NA non-coding downstream 96603 27291838 ~ 27292098 (+)
G1275732 NA non-coding downstream 103101 27298336 ~ 27298565 (+)
G1275572 NA other upstream 87807 27101309 ~ 27102027 (+)
G1274830 NA other upstream 747447 26440011 ~ 26442387 (+)
G1274765 NA other upstream 824688 26364278 ~ 26365146 (+)
rbis cssa29h8orf59 other upstream 2215121 24968304 ~ 24976522 (+)
G1276288 NA other downstream 658383 27853618 ~ 27854013 (+)
G1276733 NA other downstream 994951 28190186 ~ 28256406 (+)
G1277159 NA other downstream 1379081 28574316 ~ 28624218 (+)
G1277279 NA other downstream 1620131 28815366 ~ 28815810 (+)
G1279349 NA other downstream 3107798 30303033 ~ 30303419 (+)

Expression


G1275637 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1275637 Expression in each Bioproject

Bar chart with 19 bars.
G1275637 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network