G1276146



Basic Information


Item Value
gene id G1276146
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 27671518 ~ 27671766 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1457544
aataacgatagcggggctatatatcaggggtaccggtacagagtcaatgtgcagggtcaatgaatagcattctcacataggtgttccttttgtccaggtgtgaaaggacagtgtggagtgcaaaagagattgcatcatttgtggatctgttggggtggtatgaaaattggagtgggtctaaggtttctgggataatggtgttgatgtgagccatgaccagcctttcaaagcacttcatggctacagatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1457544 True 249 lncRNA 0.45 1 27671518 27671766
Loading

Neighbor


gene id symbol gene type direction distance location
fam49bb LOC106590167 coding upstream 108021 27524125 ~ 27563497 (+)
asap1b LOC106590164 coding upstream 152203 27452280 ~ 27519315 (+)
chpf2 LOC106590171 coding upstream 302192 27361803 ~ 27369326 (+)
LOC110489907 LOC106590173 coding upstream 320677 27332486 ~ 27350841 (+)
trnaa-ugc-66 NA coding upstream 577955 27093489 ~ 27093563 (+)
LOC110489920 LOC106590161 coding downstream 99851 27771617 ~ 27795387 (+)
vps41 vps41 coding downstream 264377 27936143 ~ 27951787 (+)
LOC110489924 LOC106590156 coding downstream 281547 27953313 ~ 27964057 (+)
lypla1 lypa1 coding downstream 377180 28048946 ~ 28051642 (+)
LOC110489930 LOC106590073 coding downstream 503719 28175485 ~ 28189640 (+)
G1276141 NA non-coding upstream 3855 27667426 ~ 27667663 (+)
G1276132 NA non-coding upstream 24882 27638553 ~ 27646636 (+)
G1275871 NA non-coding upstream 73965 27597300 ~ 27597553 (+)
G1275700 NA non-coding upstream 151418 27519625 ~ 27520100 (+)
G1275823 NA non-coding upstream 174162 27496948 ~ 27497356 (+)
G1276147 NA non-coding downstream 88 27671854 ~ 27672073 (+)
G1276232 NA non-coding downstream 80250 27752016 ~ 27752251 (+)
G1276244 NA non-coding downstream 95738 27767504 ~ 27767966 (+)
G1276246 NA non-coding downstream 97599 27769365 ~ 27769576 (+)
G1276259 NA non-coding downstream 136093 27807859 ~ 27808069 (+)
G1275572 NA other upstream 569491 27101309 ~ 27102027 (+)
kif9 kif9 other upstream 709292 26960749 ~ 26974049 (+)
G1274830 NA other upstream 1229131 26440011 ~ 26442387 (+)
G1274765 NA other upstream 1306372 26364278 ~ 26365146 (+)
rbis cssa29h8orf59 other upstream 2696805 24968304 ~ 24976522 (+)
G1276288 NA other downstream 181852 27853618 ~ 27854013 (+)
G1276733 NA other downstream 518420 28190186 ~ 28256406 (+)
G1277159 NA other downstream 902550 28574316 ~ 28624218 (+)
G1277279 NA other downstream 1143600 28815366 ~ 28815810 (+)
G1279349 NA other downstream 2631267 30303033 ~ 30303419 (+)

Expression


G1276146 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1276146 Expression in each Bioproject

Bar chart with 11 bars.
G1276146 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network