G1276288



Basic Information


Item Value
gene id G1276288
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 27853618 ~ 27854013 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1457707
gtcgtatattgcacaaatctggcctttatggaagagtggcaagaaggaagacatttcttaaagatatccataaaaagtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcatgtgaaaccaaaatggaactttttggcaacaatgcaaaacattatgtttggcgtaaaagcaacacagctcatcagcctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgg

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1457707 True 396 TUCP 0.44 1 27853618 27854013

Neighbor


gene id symbol gene type direction distance location
LOC110489920 LOC106590161 coding upstream 58231 27771617 ~ 27795387 (+)
fam49bb LOC106590167 coding upstream 290121 27524125 ~ 27563497 (+)
asap1b LOC106590164 coding upstream 334303 27452280 ~ 27519315 (+)
chpf2 LOC106590171 coding upstream 484292 27361803 ~ 27369326 (+)
LOC110489907 LOC106590173 coding upstream 502777 27332486 ~ 27350841 (+)
vps41 vps41 coding downstream 82130 27936143 ~ 27951787 (+)
LOC110489924 LOC106590156 coding downstream 99300 27953313 ~ 27964057 (+)
lypla1 lypa1 coding downstream 194933 28048946 ~ 28051642 (+)
LOC110489930 LOC106590073 coding downstream 321472 28175485 ~ 28189640 (+)
LOC110489931 LOC106590150 coding downstream 346599 28200612 ~ 28204289 (+)
G1276287 NA non-coding upstream 78 27853132 ~ 27853540 (+)
G1276274 NA non-coding upstream 16430 27836253 ~ 27837188 (+)
G1276259 NA non-coding upstream 45549 27807859 ~ 27808069 (+)
G1276246 NA non-coding upstream 84042 27769365 ~ 27769576 (+)
G1276244 NA non-coding upstream 85652 27767504 ~ 27767966 (+)
G1276317 NA non-coding downstream 56890 27910903 ~ 27911277 (+)
G1276471 NA non-coding downstream 79069 27933082 ~ 27933318 (+)
G1276479 NA non-coding downstream 110445 27964458 ~ 27966280 (+)
G1276489 NA non-coding downstream 128993 27983006 ~ 27983363 (+)
G1276494 NA non-coding downstream 132619 27986632 ~ 27987021 (+)
G1275572 NA other upstream 751591 27101309 ~ 27102027 (+)
kif9 kif9 other upstream 891392 26960749 ~ 26974049 (+)
G1274830 NA other upstream 1411231 26440011 ~ 26442387 (+)
G1274765 NA other upstream 1488472 26364278 ~ 26365146 (+)
rbis cssa29h8orf59 other upstream 2878905 24968304 ~ 24976522 (+)
G1276733 NA other downstream 336173 28190186 ~ 28256406 (+)
G1277159 NA other downstream 720303 28574316 ~ 28624218 (+)
G1277279 NA other downstream 961353 28815366 ~ 28815810 (+)
G1279349 NA other downstream 2449020 30303033 ~ 30303419 (+)
htr5ab htr5a other downstream 2541854 30395817 ~ 30416375 (+)

Expression


G1276288 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1276288 Expression in each Bioproject

Bar chart with 17 bars.
G1276288 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network