G1276489



Basic Information


Item Value
gene id G1276489
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 27983006 ~ 27983363 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1457948
aaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagtagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccattaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaacaagtttaaagccggatttggatacaaaacgatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1457948 True 358 lncRNA 0.41 1 27983006 27983363
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110489924 LOC106590156 coding upstream 18949 27953313 ~ 27964057 (+)
vps41 vps41 coding upstream 31219 27936143 ~ 27951787 (+)
LOC110489920 LOC106590161 coding upstream 187619 27771617 ~ 27795387 (+)
fam49bb LOC106590167 coding upstream 419509 27524125 ~ 27563497 (+)
asap1b LOC106590164 coding upstream 463691 27452280 ~ 27519315 (+)
lypla1 lypa1 coding downstream 65583 28048946 ~ 28051642 (+)
LOC110489930 LOC106590073 coding downstream 192122 28175485 ~ 28189640 (+)
LOC110489931 LOC106590150 coding downstream 217249 28200612 ~ 28204289 (+)
LOC110489932 LOC106590150 coding downstream 222354 28205717 ~ 28216245 (+)
chmp5b LOC106590149 coding downstream 239215 28222578 ~ 28227687 (+)
G1276479 NA non-coding upstream 16726 27964458 ~ 27966280 (+)
G1276471 NA non-coding upstream 49688 27933082 ~ 27933318 (+)
G1276317 NA non-coding upstream 71729 27910903 ~ 27911277 (+)
G1276287 NA non-coding upstream 129466 27853132 ~ 27853540 (+)
G1276274 NA non-coding upstream 145818 27836253 ~ 27837188 (+)
G1276494 NA non-coding downstream 3269 27986632 ~ 27987021 (+)
G1276505 NA non-coding downstream 15946 27999309 ~ 27999555 (+)
G1276630 NA non-coding downstream 102962 28086325 ~ 28086580 (+)
G1276632 NA non-coding downstream 103684 28087047 ~ 28087286 (+)
G1276636 NA non-coding downstream 105054 28088417 ~ 28088685 (+)
G1276288 NA other upstream 128993 27853618 ~ 27854013 (+)
G1275572 NA other upstream 880979 27101309 ~ 27102027 (+)
kif9 kif9 other upstream 1020780 26960749 ~ 26974049 (+)
G1274830 NA other upstream 1540619 26440011 ~ 26442387 (+)
G1274765 NA other upstream 1617860 26364278 ~ 26365146 (+)
G1276733 NA other downstream 206823 28190186 ~ 28256406 (+)
G1277159 NA other downstream 590953 28574316 ~ 28624218 (+)
G1277279 NA other downstream 832003 28815366 ~ 28815810 (+)
G1279349 NA other downstream 2319670 30303033 ~ 30303419 (+)
htr5ab htr5a other downstream 2412504 30395817 ~ 30416375 (+)

Expression


G1276489 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1276489 Expression in each Bioproject

Bar chart with 20 bars.
G1276489 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network