G1276632



Basic Information


Item Value
gene id G1276632
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 28087047 ~ 28087286 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1458096
gcgtacacatcacggataaactgaattggtccacccacacagacagcgttgtgaagaaggcgcagcagcgcctcttcaacctcaggaggctgaagaaattcagcttgtcaccaaaagcactcacaaacttctacagatgcacgatcgagagcatcctgtcgggctgtatcaccgcctggtacggcaactgctctgcccacaaccgtaaggctctccagagggtagtgaggtctgcacaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1458096 True 240 lncRNA 0.54 1 28087047 28087286

Neighbor


gene id symbol gene type direction distance location
lypla1 lypa1 coding upstream 35405 28048946 ~ 28051642 (+)
LOC110489924 LOC106590156 coding upstream 122990 27953313 ~ 27964057 (+)
vps41 vps41 coding upstream 135260 27936143 ~ 27951787 (+)
LOC110489920 LOC106590161 coding upstream 291660 27771617 ~ 27795387 (+)
fam49bb LOC106590167 coding upstream 523550 27524125 ~ 27563497 (+)
LOC110489930 LOC106590073 coding downstream 88199 28175485 ~ 28189640 (+)
LOC110489931 LOC106590150 coding downstream 113326 28200612 ~ 28204289 (+)
LOC110489932 LOC106590150 coding downstream 118431 28205717 ~ 28216245 (+)
chmp5b LOC106590149 coding downstream 135292 28222578 ~ 28227687 (+)
myom1b LOC106590144 coding downstream 159232 28246518 ~ 28281728 (+)
G1276630 NA non-coding upstream 467 28086325 ~ 28086580 (+)
G1276505 NA non-coding upstream 87492 27999309 ~ 27999555 (+)
G1276494 NA non-coding upstream 100026 27986632 ~ 27987021 (+)
G1276489 NA non-coding upstream 103684 27983006 ~ 27983363 (+)
G1276479 NA non-coding upstream 120767 27964458 ~ 27966280 (+)
G1276636 NA non-coding downstream 1131 28088417 ~ 28088685 (+)
G1276640 NA non-coding downstream 4144 28091430 ~ 28091756 (+)
G1276655 NA non-coding downstream 14200 28101486 ~ 28101693 (+)
G1276658 NA non-coding downstream 16034 28103320 ~ 28103612 (+)
G1276682 NA non-coding downstream 147121 28234407 ~ 28236826 (+)
G1276288 NA other upstream 233034 27853618 ~ 27854013 (+)
G1275572 NA other upstream 985020 27101309 ~ 27102027 (+)
kif9 kif9 other upstream 1124821 26960749 ~ 26974049 (+)
G1274830 NA other upstream 1644660 26440011 ~ 26442387 (+)
G1274765 NA other upstream 1721901 26364278 ~ 26365146 (+)
G1276733 NA other downstream 102900 28190186 ~ 28256406 (+)
G1277159 NA other downstream 487030 28574316 ~ 28624218 (+)
G1277279 NA other downstream 728080 28815366 ~ 28815810 (+)
G1279349 NA other downstream 2215747 30303033 ~ 30303419 (+)
htr5ab htr5a other downstream 2308581 30395817 ~ 30416375 (+)

Expression


G1276632 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1276632 Expression in each Bioproject

Bar chart with 16 bars.
G1276632 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network