G1277159



Basic Information


Item Value
gene id G1277159
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 28574316 ~ 28624218 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1458658
atcacattgtagaatttttaatgaatttatttgcaaattatggtggaaaagaagtatttggtcacctacaaacaagcaagatttctggctctcacagacctgtaacttcttctttaagaggctcctctgtcctccactcgttacctgtattaatggcacctgtttgaacttgttatcagtataaaagacacctgtccacaacctcaaacagttacacttcaaactccactatggccaagaccaaagagctgtcaaaggacaccagaaacaaaattgtagacctgcaccaggctgggaagactgaatctgcaataggtaagcagcttggtttgaagaaatcaactgtgggagcaattatttggaaatggaagacatacaagaccactgataatctccctcgatctggggctccacgcaagatctcaccccgtggggtcaaaatgatcacaaggacggtgagcaaaaatcccagaaccacacggggggacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagtaacacactacgccgccagggac
>TU1458659
atcacattgtagaatttttaatgaatttatttgcaaattatggtggaaaagaagtatttggtcacctacaaacaagcaagatttctggctctcacagacctgtaacttcttctttaagaggctcctctgtcctccactcgttacctgtattaatggcacctgtttgaacttgttatcagtataaaagacacctgtccacaacctcaaacagccacactccaaactccactatggccaagaccaaagggctgtcaaaggacaccagaaacaaaattgtagacctgcaccaggctgggaagagtgaatctgcaataggtaagcagcttggtttgaagacatCAACTTTGggtgcaattattaggaaatggaagacatacaagaccactgatctcaccaatctccctcgatctggggctccacgcaagatctcaccccgtggggtcaaaatgatcacaaggacggtgagcaaaaatcccagaaccacacggggggacctagtgaatgacctgcagagagctgggaccaaagtaacaaagcctaccatcagtaacacactacgccgccagggac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1458658 False 564 TUCP 0.45 2 28574316 28624218
TU1458659 True 570 TUCP 0.45 2 28574316 28624218

Neighbor


gene id symbol gene type direction distance location
mettl4 mettl4 coding upstream 184787 28377804 ~ 28389529 (+)
LOC110489939 LOC106590143 coding upstream 257946 28281872 ~ 28316370 (+)
myom1b LOC106590144 coding upstream 292588 28246518 ~ 28281728 (+)
chmp5b LOC106590149 coding upstream 346629 28222578 ~ 28227687 (+)
LOC110489932 LOC106590150 coding upstream 358071 28205717 ~ 28216245 (+)
LOC100136716 LOC106590136 coding downstream 13529 28637747 ~ 28698956 (+)
LOC110490831 LOC106590071 coding downstream 106858 28731076 ~ 28741476 (+)
LOC110489948 mrc1 coding downstream 132570 28756788 ~ 28777089 (+)
LOC110489949 mrc1 coding downstream 170862 28795080 ~ 28812062 (+)
LOC110489950 LOC106590132 coding downstream 202362 28826580 ~ 28837296 (+)
G1277145 NA non-coding upstream 29331 28544680 ~ 28544985 (+)
G1277144 NA non-coding upstream 29694 28544338 ~ 28544622 (+)
G1277136 NA non-coding upstream 37774 28536278 ~ 28536542 (+)
G1277000 NA non-coding upstream 137352 28436747 ~ 28436964 (+)
G1276996 NA non-coding upstream 139117 28434939 ~ 28435199 (+)
G1277177 NA non-coding downstream 1287 28625505 ~ 28626332 (+)
G1277178 clul1 non-coding downstream 2369 28626587 ~ 28631165 (+)
G1277186 NA non-coding downstream 76985 28701203 ~ 28703108 (+)
G1277276 NA non-coding downstream 187957 28812175 ~ 28812749 (+)
G1277277 NA non-coding downstream 188965 28813183 ~ 28813383 (+)
G1276733 NA other upstream 317910 28190186 ~ 28256406 (+)
G1276288 NA other upstream 720303 27853618 ~ 27854013 (+)
G1275572 NA other upstream 1472289 27101309 ~ 27102027 (+)
kif9 kif9 other upstream 1612090 26960749 ~ 26974049 (+)
G1274830 NA other upstream 2131929 26440011 ~ 26442387 (+)
G1277279 NA other downstream 191148 28815366 ~ 28815810 (+)
G1279349 NA other downstream 1678815 30303033 ~ 30303419 (+)
htr5ab htr5a other downstream 1771649 30395817 ~ 30416375 (+)
G1279833 NA other downstream 2319953 30944171 ~ 30947330 (+)
G1281462 NA other downstream 3371949 31996167 ~ 31996513 (+)

Expression


G1277159 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1277159 Expression in each Bioproject

Bar chart with 21 bars.
G1277159 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network