G1277174 (clul1)


Basic Information

Item Value
gene id G1277174
gene name clul1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 28619969 ~ 28620709 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1458676
GTCACAGTTTAATCATCAGTAAAATGTAAAAGTTGATCAAACACATGTTGCTTACATTATTTTATTCCATCACTTAGTGTATAGAGTATAGCTCGTAGCTCGACCAAATGTTGCATACAACCTTAAACATAATGCTTCATTCCAAGGAACTGGTAGACACACAATGGTAAATTGAGGCTTATGAATAGCACAGCTTGCAAAATCCTCAGATTACTTCATATCTTTGACTGTTTGTAGTGGGCCAGGGCCTCTTGGGCCACATACTGAATGAAGGCAGAGTCCTGCACCTCTAGCTCTGCTGGGACGGAGAGGGTTAATGAAGGAGAGTTCAGGATGTTCAACACCACTCTGGTGTCACCTTTAAACCCGTTATCCCTCACCTGTAGAACCACCGCGCTCACACCGAAGACGTACTGAGGACCCAGGGTGCCATT

Function

symbol description
clul1 Predicted to enable misfolded protein binding activity. Predicted to be located in extracellular region. Predicted to be active in extracellular space and nucleus. Is expressed in cranial blood vessel and photoreceptor cell. Orthologous to human CLUL1 (clusterin like 1).

NR:

description
clusterin-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1458676 True 434 lncRNA 0.44 3 28619969 28620709

Neighbor

gene id symbol gene type direction distance location
LOC110489944 LOC106590138 coding upstream 7932 28580623 ~ 28612037 (+)
mettl4 mettl4 coding upstream 230440 28377804 ~ 28389529 (+)
LOC110489939 LOC106590143 coding upstream 303599 28281872 ~ 28316370 (+)
myom1b LOC106590144 coding upstream 338241 28246518 ~ 28281728 (+)
chmp5b LOC106590149 coding upstream 392282 28222578 ~ 28227687 (+)
LOC100136716 LOC106590136 coding downstream 17038 28637747 ~ 28698956 (+)
LOC110490831 LOC106590071 coding downstream 110367 28731076 ~ 28741476 (+)
LOC110489948 mrc1 coding downstream 136079 28756788 ~ 28777089 (+)
LOC110489949 mrc1 coding downstream 174371 28795080 ~ 28812062 (+)
LOC110489950 LOC106590132 coding downstream 205871 28826580 ~ 28837296 (+)
G1277128 NA non-coding upstream 3288 28614402 ~ 28616681 (+)
G1277145 NA non-coding upstream 74984 28544680 ~ 28544985 (+)
G1277144 NA non-coding upstream 75347 28544338 ~ 28544622 (+)
G1277136 NA non-coding upstream 83427 28536278 ~ 28536542 (+)
G1277000 NA non-coding upstream 183005 28436747 ~ 28436964 (+)
G1277177 NA non-coding downstream 4796 28625505 ~ 28626332 (+)
G1277178 clul1 non-coding downstream 5878 28626587 ~ 28631165 (+)
G1277186 NA non-coding downstream 80494 28701203 ~ 28703108 (+)
G1277276 NA non-coding downstream 191466 28812175 ~ 28812749 (+)
G1277277 NA non-coding downstream 192474 28813183 ~ 28813383 (+)
G1276733 NA other upstream 363563 28190186 ~ 28256406 (+)
G1276288 NA other upstream 765956 27853618 ~ 27854013 (+)
G1275572 NA other upstream 1517942 27101309 ~ 27102027 (+)
kif9 kif9 other upstream 1657743 26960749 ~ 26974049 (+)
G1274830 NA other upstream 2177582 26440011 ~ 26442387 (+)
G1277279 NA other downstream 194657 28815366 ~ 28815810 (+)
G1279349 NA other downstream 1682324 30303033 ~ 30303419 (+)
htr5ab htr5a other downstream 1775158 30395817 ~ 30416375 (+)
G1279833 NA other downstream 2323462 30944171 ~ 30947330 (+)
G1281462 NA other downstream 3375458 31996167 ~ 31996513 (+)

Expression


Co-expression Network