G1281205



Basic Information


Item Value
gene id G1281205
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 31788666 ~ 31788923 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1462996
GCACGGGCCTGCTAGCTGACTTGGTCGTCAAGTTCACCGGTTTGCCACTAGCCACCTGCGACCACAAAGGAATGCACAGCGCAGTGATGTTGGAACATGGGAACATACAGTTCTGGGAATTAAAAAAGTGAAACTGTACTGCAGTTCAATAAAAAACATTTGCTTCAAAGTGGATGTACTGTACCTGCACCGTCATTACATGTTGTATTGCAAATGAACTAGCATTTGGCAGCATGTTTGTCACATTAACAATGTACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1462996 True 258 lncRNA 0.44 1 31788666 31788923
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490002 LOC106590088 coding downstream 30507 31750154 ~ 31758159 (-)
LOC110490955 NA coding downstream 160265 31616010 ~ 31628401 (-)
LOC118938914 NA coding downstream 360494 31424841 ~ 31428172 (-)
maf1b LOC106590091 coding downstream 392279 31368447 ~ 31396409 (-)
si:ch73-174h16.4 LOC106590092 coding downstream 444003 31340731 ~ 31344663 (-)
dipk1c LOC106590086 coding upstream 35499 31824422 ~ 31846012 (-)
tubb6 LOC106590085 coding upstream 82591 31871514 ~ 31884515 (-)
cidea LOC106590084 coding upstream 98400 31887323 ~ 31901387 (-)
LOC110490834 NA coding upstream 229476 32018399 ~ 32032349 (-)
sugct LOC106590081 coding upstream 332008 32120931 ~ 32286220 (-)
G1281204 NA non-coding downstream 120 31788297 ~ 31788546 (-)
G1281184 NA non-coding downstream 12906 31775558 ~ 31775760 (-)
G1280892 NA non-coding downstream 227093 31561341 ~ 31561573 (-)
G1280882 NA non-coding downstream 235924 31552535 ~ 31552742 (-)
G1280878 NA non-coding downstream 239133 31549048 ~ 31549533 (-)
G1281213 NA non-coding upstream 3369 31792292 ~ 31792759 (-)
G1281220 NA non-coding upstream 8035 31796958 ~ 31797202 (-)
G1281365 NA non-coding upstream 78745 31867668 ~ 31867900 (-)
G1281348 NA non-coding upstream 134563 31923486 ~ 31924463 (-)
G1281508 NA non-coding upstream 161655 31950578 ~ 31951012 (-)
dlgap1b LOC106590111 other downstream 1800150 29979175 ~ 30253803 (-)
G1278860 NA other downstream 2156898 29631025 ~ 29631768 (-)
LOC110489947 LOC106590135 other downstream 3085113 28701177 ~ 28724125 (-)
adcyap1a paca other downstream 3223153 28559194 ~ 28565541 (-)
G1276905 NA other downstream 3522911 28261540 ~ 28265755 (-)
G1281361 NA other upstream 75311 31864234 ~ 31864636 (-)
G1281363 NA other upstream 76366 31865289 ~ 31866137 (-)
G1282159 LOC106590060 other upstream 686996 32475919 ~ 32478516 (-)
G1283257 NA other upstream 1473657 33262580 ~ 33266218 (-)
G1285645 NA other upstream 3195930 34984853 ~ 34985274 (-)

Expression


G1281205 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1281205 Expression in each Bioproject

Bar chart with 4 bars.
G1281205 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network