G1281363



Basic Information


Item Value
gene id G1281363
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 31865289 ~ 31866137 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1463176
cgctatcggagtcggtgcagccagctggtttctccacgcatcgcgccgacagaaacaaacatctttctggtaagaagaggggcgggggggtatgcttcatggttaacgtgacgtggtgtggccacaacaacatacaggaactcaagtccttctgttcacctgatttagaattcctcacaatcaaatgtcgaccgcattatctaccaagggaattctcttcgattataatcacagccgtatatattcccccccaagcagacacatcgatggctctgaacaaactttatttgactctttgcaaactggaatccatatatctggaggctgcattcattgtagctggggattttaacaaggctaatctgaaaacaagactccctaaattgtatcagcatatcgattgcgcaaccagggctggaaaaaccttggatcattgctattctaacttccgcgacgcatataaggccctgccccgctctcctttcggaaaagctgaccacgactccattttgttgatccctgcctacagacagaaactaaaacaagaagctcccgcgctgaggtctgttcaacgctggtccgaccaatctgattccacactccaagactgcttccatcacgtggactgggatatgtttcgtattgcgtcagacaacaacattgacgaatacgctgattcggtgagcgagttcattagaacgtgcgttgaagatgtcgttcccatagcaacgattaaaacattcccaaaccagaaaccgtggattgatggcagcattcgcgtgaaactgaaagcgcaaaccattgcttttaatcagggcaaggtgaccggaaacatgaccgtatacaaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1463176 True 849 TUCP 0.47 1 31865289 31866137
Loading

Neighbor


gene id symbol gene type direction distance location
dipk1c LOC106590086 coding downstream 19277 31824422 ~ 31846012 (-)
LOC110490002 LOC106590088 coding downstream 107130 31750154 ~ 31758159 (-)
LOC110490955 NA coding downstream 236888 31616010 ~ 31628401 (-)
LOC118938914 NA coding downstream 437117 31424841 ~ 31428172 (-)
maf1b LOC106590091 coding downstream 468902 31368447 ~ 31396409 (-)
tubb6 LOC106590085 coding upstream 5377 31871514 ~ 31884515 (-)
cidea LOC106590084 coding upstream 21186 31887323 ~ 31901387 (-)
LOC110490834 NA coding upstream 152262 32018399 ~ 32032349 (-)
sugct LOC106590081 coding upstream 254794 32120931 ~ 32286220 (-)
LOC110490012 LOC106590058 coding upstream 691601 32557738 ~ 32679847 (-)
G1281220 NA non-coding downstream 68087 31796958 ~ 31797202 (-)
G1281213 NA non-coding downstream 72530 31792292 ~ 31792759 (-)
G1281205 NA non-coding downstream 76366 31788666 ~ 31788923 (-)
G1281204 NA non-coding downstream 76743 31788297 ~ 31788546 (-)
G1281184 NA non-coding downstream 89529 31775558 ~ 31775760 (-)
G1281365 NA non-coding upstream 1531 31867668 ~ 31867900 (-)
G1281348 NA non-coding upstream 57349 31923486 ~ 31924463 (-)
G1281508 NA non-coding upstream 84441 31950578 ~ 31951012 (-)
G1281509 NA non-coding upstream 86766 31952903 ~ 31953114 (-)
G1281511 NA non-coding upstream 89675 31955812 ~ 31956014 (-)
G1281361 NA other downstream 653 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 1876773 29979175 ~ 30253803 (-)
G1278860 NA other downstream 2233521 29631025 ~ 29631768 (-)
LOC110489947 LOC106590135 other downstream 3161736 28701177 ~ 28724125 (-)
adcyap1a paca other downstream 3299776 28559194 ~ 28565541 (-)
G1282159 LOC106590060 other upstream 609782 32475919 ~ 32478516 (-)
G1283257 NA other upstream 1396443 33262580 ~ 33266218 (-)
G1285645 NA other upstream 3118716 34984853 ~ 34985274 (-)
G1287067 NA other upstream 4292299 36158436 ~ 36158733 (-)
G1288280 NA other upstream 5373037 37239174 ~ 37239410 (-)

Expression


G1281363 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1281363 Expression in each Bioproject

Bar chart with 20 bars.
G1281363 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network