G1282760



Basic Information


Item Value
gene id G1282760
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 32944912 ~ 32945170 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1464635
AAATTGAACCTTGAAGACAATGATTGCTTCCTATGTAGGGACCCAGCACAAACACTGGGACAAGCATCTTCACGAGTTTCGATTTGCACTGAATTCTGCAGTGCAAGAGTCCACTTGAGTCACACCTGCAGAGCTGAACCTAAGTCGTCCCCTCCGAGGACCCTTGGATATGGTGCTACAGCCCCAGCAGCTTACTCCAGACGCTGCTTGCTATGACCAGGTAGTCCATCTCCATGACTTGAGAGCTCTTGTTTCAAAG

Function


NR:

description
PREDICTED: uncharacterized protein LOC109094915

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1464635 True 259 lncRNA 0.49 1 32944912 32945170

Neighbor


gene id symbol gene type direction distance location
LOC110490012 LOC106590058 coding downstream 265065 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 658692 32120931 ~ 32286220 (-)
LOC110490834 NA coding downstream 912563 32018399 ~ 32032349 (-)
cidea LOC106590084 coding downstream 1043525 31887323 ~ 31901387 (-)
tubb6 LOC106590085 coding downstream 1060397 31871514 ~ 31884515 (-)
LOC110490014 LOC106590055 coding upstream 321834 33267004 ~ 33348714 (-)
LOC118938795 NA coding upstream 346059 33291229 ~ 33294593 (-)
LOC110516899 LOC106595224 coding upstream 958774 33903944 ~ 33906267 (-)
LOC118938915 NA coding upstream 1966065 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 3093608 36038778 ~ 36142327 (-)
G1282735 NA non-coding downstream 25539 32919002 ~ 32919373 (-)
G1282712 NA non-coding downstream 39080 32899625 ~ 32905832 (-)
G1282695 NA non-coding downstream 66339 32878318 ~ 32878573 (-)
G1282688 NA non-coding downstream 69179 32875481 ~ 32875733 (-)
G1282687 NA non-coding downstream 70081 32874574 ~ 32874831 (-)
G1282785 NA non-coding upstream 19396 32964566 ~ 32964852 (-)
G1282787 NA non-coding upstream 21094 32966264 ~ 32966495 (-)
G1282788 NA non-coding upstream 21628 32966798 ~ 32967035 (-)
G1282854 NA non-coding upstream 71230 33016400 ~ 33016632 (-)
G1283033 NA non-coding upstream 200181 33145351 ~ 33145585 (-)
G1282159 LOC106590060 other downstream 466396 32475919 ~ 32478516 (-)
G1281363 NA other downstream 1078775 31865289 ~ 31866137 (-)
G1281361 NA other downstream 1080276 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 2956396 29979175 ~ 30253803 (-)
G1278860 NA other downstream 3313144 29631025 ~ 29631768 (-)
G1283257 NA other upstream 317410 33262580 ~ 33266218 (-)
G1285645 NA other upstream 2039683 34984853 ~ 34985274 (-)
G1287067 NA other upstream 3213266 36158436 ~ 36158733 (-)
G1288280 NA other upstream 4294004 37239174 ~ 37239410 (-)
G1288297 NA other upstream 4315845 37261015 ~ 37261648 (-)

Expression


G1282760 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1282760 Expression in each Bioproject

Bar chart with 8 bars.
G1282760 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network