G1283061



Basic Information


Item Value
gene id G1283061
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 33160017 ~ 33160798 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1464949
aaattctcgattggattcaggtctggactttgacttgggcattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccgtgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtgggggtggtgtgttcagggtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaatgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagagctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgaatCCAAATCCGGc
>TU1464946
aaattctcgattggattcaggtctggactttgacttgggcattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccgtgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtgg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1464949 False 782 lncRNA 0.44 1 33160017 33160798
TU1464946 True 295 lncRNA 0.43 1 33160504 33160798

Neighbor


gene id symbol gene type direction distance location
LOC110490012 LOC106590058 coding downstream 480170 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 873797 32120931 ~ 32286220 (-)
LOC110490834 NA coding downstream 1127668 32018399 ~ 32032349 (-)
cidea LOC106590084 coding downstream 1258630 31887323 ~ 31901387 (-)
tubb6 LOC106590085 coding downstream 1275502 31871514 ~ 31884515 (-)
LOC110490014 LOC106590055 coding upstream 106206 33267004 ~ 33348714 (-)
LOC118938795 NA coding upstream 130431 33291229 ~ 33294593 (-)
LOC110516899 LOC106595224 coding upstream 743146 33903944 ~ 33906267 (-)
LOC118938915 NA coding upstream 1750437 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 2877980 36038778 ~ 36142327 (-)
G1283044 NA non-coding downstream 8564 33151230 ~ 33151453 (-)
G1283033 NA non-coding downstream 14432 33145351 ~ 33145585 (-)
G1282854 NA non-coding downstream 143385 33016400 ~ 33016632 (-)
G1282788 NA non-coding downstream 192982 32966798 ~ 32967035 (-)
G1282787 NA non-coding downstream 193522 32966264 ~ 32966495 (-)
G1283131 NA non-coding upstream 64689 33225487 ~ 33225707 (-)
G1283139 NA non-coding upstream 70579 33231377 ~ 33231577 (-)
G1283328 NA non-coding upstream 195984 33356782 ~ 33357491 (-)
G1283330 NA non-coding upstream 197475 33358273 ~ 33358520 (-)
G1282159 LOC106590060 other downstream 681501 32475919 ~ 32478516 (-)
G1281363 NA other downstream 1293880 31865289 ~ 31866137 (-)
G1281361 NA other downstream 1295381 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 3171501 29979175 ~ 30253803 (-)
G1278860 NA other downstream 3528249 29631025 ~ 29631768 (-)
G1283257 NA other upstream 101782 33262580 ~ 33266218 (-)
G1285645 NA other upstream 1824055 34984853 ~ 34985274 (-)
G1287067 NA other upstream 2997638 36158436 ~ 36158733 (-)
G1288280 NA other upstream 4078376 37239174 ~ 37239410 (-)
G1288297 NA other upstream 4100217 37261015 ~ 37261648 (-)

Expression


G1283061 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1283061 Expression in each Bioproject

Bar chart with 21 bars.
G1283061 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network