G1283428


Basic Information

Item Value
gene id G1283428
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 33428509 ~ 33432652 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1465343
ctgcttgtacttttccatttgatataggggagaaaccatgtgtccaagaacgatatatcaatgaagagatatgtgaaaaacaccttgatgattgattctaaacaacgtttgccatgttttcagtcgatattatggagttaatttggaaaaaagttcgcgttttgaggactgaattttctggtttttttggtagccaaatgtgatgtataaaacggagctatttctaatacacaaagaatctttttggaaaaactgagcatctgctatctaactgagagtatcctcattgaaaacatcagaagttcttcaaaggtaaattattttatttgaaggcttttatgtttttgttgaaatgttgcgtgctggatgctaacgctaatgctaacgctaaatgctacgctagctagctacttttacacaaattattgttttcctatggttgagaagcatattttgaaaatctgagatgacagtgttgtttacaaaaggctaagcttgcgagatggcatatttatttcatttcatttgcgattttcatgaatagttaacgttgcgttatggtaatgagcttgaggctgtagtcacgataccggatccgggtttgggagatcagagaggttaaca

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1465343 True 624 lncRNA 0.36 2 33428509 33432652
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110490014 LOC106590055 coding downstream 79795 33267004 ~ 33348714 (-)
LOC118938795 NA coding downstream 133916 33291229 ~ 33294593 (-)
LOC110490012 LOC106590058 coding downstream 748662 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 1142289 32120931 ~ 32286220 (-)
LOC110490834 NA coding downstream 1396160 32018399 ~ 32032349 (-)
LOC110516899 LOC106595224 coding upstream 471292 33903944 ~ 33906267 (-)
LOC118938915 NA coding upstream 1478583 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 2606126 36038778 ~ 36142327 (-)
LOC110490717 LOC106590044 coding upstream 2882786 36315438 ~ 36462331 (-)
LOC110490025 LOC106590045 coding upstream 3071256 36503908 ~ 36545570 (-)
G1283389 NA non-coding downstream 33119 33394937 ~ 33395390 (-)
G1283388 NA non-coding downstream 34418 33393762 ~ 33394091 (-)
G1283376 NA non-coding downstream 42179 33386023 ~ 33386330 (-)
G1283345 NA non-coding downstream 61632 33366653 ~ 33366877 (-)
G1283330 NA non-coding downstream 69989 33358273 ~ 33358520 (-)
G1283445 NA non-coding upstream 9910 33442562 ~ 33442771 (-)
G1283448 NA non-coding upstream 13268 33445920 ~ 33446213 (-)
G1283478 NA non-coding upstream 40108 33472760 ~ 33473002 (-)
G1283483 NA non-coding upstream 42990 33475642 ~ 33475922 (-)
G1283489 NA non-coding upstream 47487 33480139 ~ 33480348 (-)
G1283257 NA other downstream 162291 33262580 ~ 33266218 (-)
G1282159 LOC106590060 other downstream 949993 32475919 ~ 32478516 (-)
G1281363 NA other downstream 1562372 31865289 ~ 31866137 (-)
G1281361 NA other downstream 1563873 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 3439993 29979175 ~ 30253803 (-)
G1285645 NA other upstream 1552201 34984853 ~ 34985274 (-)
G1287067 NA other upstream 2725784 36158436 ~ 36158733 (-)
G1288280 NA other upstream 3806522 37239174 ~ 37239410 (-)
G1288297 NA other upstream 3828363 37261015 ~ 37261648 (-)
G1289323 LOC106590025 other upstream 4577541 38010193 ~ 38011916 (-)

Expression

G1283428 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1283428 Expression in each Bioproject

Bar chart with 18 bars.
G1283428 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network