G1283653



Basic Information


Item Value
gene id G1283653
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 33600478 ~ 33600737 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1465571
tgttcatattttaataaatcactacacatgaacaaactaacgaaaacaagaaatgtgagaacgcaaaccagtcctatcctgtgacgacaaacacagtgacaggaacaatcacccacaaacacacagtgaaacccaggctacctaagtatgattctcaatcagagacaactaatgacacctgcctctgattgagaaccatactaggccgaaaacatagaaatgccccaaaacatagaaaaacaaatatagactgcccaccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1465571 True 260 lncRNA 0.40 1 33600478 33600737
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490014 LOC106590055 coding downstream 251764 33267004 ~ 33348714 (-)
LOC118938795 NA coding downstream 305885 33291229 ~ 33294593 (-)
LOC110490012 LOC106590058 coding downstream 920631 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 1314258 32120931 ~ 32286220 (-)
LOC110490834 NA coding downstream 1568129 32018399 ~ 32032349 (-)
LOC110516899 LOC106595224 coding upstream 303207 33903944 ~ 33906267 (-)
LOC118938915 NA coding upstream 1310498 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 2438041 36038778 ~ 36142327 (-)
LOC110490717 LOC106590044 coding upstream 2714701 36315438 ~ 36462331 (-)
LOC110490025 LOC106590045 coding upstream 2903171 36503908 ~ 36545570 (-)
G1283497 NA non-coding downstream 108648 33491610 ~ 33491830 (-)
G1283489 NA non-coding downstream 120130 33480139 ~ 33480348 (-)
G1283483 NA non-coding downstream 124556 33475642 ~ 33475922 (-)
G1283478 NA non-coding downstream 127476 33472760 ~ 33473002 (-)
G1283448 NA non-coding downstream 154265 33445920 ~ 33446213 (-)
G1283693 NA non-coding upstream 23741 33624478 ~ 33624754 (-)
G1283696 NA non-coding upstream 26036 33626773 ~ 33626997 (-)
G1283702 NA non-coding upstream 30188 33630925 ~ 33631154 (-)
G1283727 NA non-coding upstream 44137 33644874 ~ 33645531 (-)
G1283730 NA non-coding upstream 46279 33647016 ~ 33647228 (-)
G1283257 NA other downstream 334260 33262580 ~ 33266218 (-)
G1282159 LOC106590060 other downstream 1121962 32475919 ~ 32478516 (-)
G1281363 NA other downstream 1734341 31865289 ~ 31866137 (-)
G1281361 NA other downstream 1735842 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 3611962 29979175 ~ 30253803 (-)
G1285645 NA other upstream 1384116 34984853 ~ 34985274 (-)
G1287067 NA other upstream 2557699 36158436 ~ 36158733 (-)
G1288280 NA other upstream 3638437 37239174 ~ 37239410 (-)
G1288297 NA other upstream 3660278 37261015 ~ 37261648 (-)
G1289323 LOC106590025 other upstream 4409456 38010193 ~ 38011916 (-)

Expression


G1283653 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1283653 Expression in each Bioproject

Bar chart with 13 bars.
G1283653 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network