G1283727


Basic Information

Item Value
gene id G1283727
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 33644874 ~ 33645531 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1465645
attccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcagtcccaaaccatgatgctgccaccaccatgtttgacagtggtgatggtgtgttcagggtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgacccgagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatgaacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgaccagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatacttcttccatttcaatattatcgcttgcacagt

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1465645 True 658 lncRNA 0.44 1 33644874 33645531
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110490014 LOC106590055 coding downstream 296160 33267004 ~ 33348714 (-)
LOC118938795 NA coding downstream 350281 33291229 ~ 33294593 (-)
LOC110490012 LOC106590058 coding downstream 965027 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 1358654 32120931 ~ 32286220 (-)
LOC110490834 NA coding downstream 1612525 32018399 ~ 32032349 (-)
LOC110516899 LOC106595224 coding upstream 258413 33903944 ~ 33906267 (-)
LOC118938915 NA coding upstream 1265704 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 2393247 36038778 ~ 36142327 (-)
LOC110490717 LOC106590044 coding upstream 2669907 36315438 ~ 36462331 (-)
LOC110490025 LOC106590045 coding upstream 2858377 36503908 ~ 36545570 (-)
G1283702 NA non-coding downstream 13720 33630925 ~ 33631154 (-)
G1283696 NA non-coding downstream 17877 33626773 ~ 33626997 (-)
G1283693 NA non-coding downstream 20120 33624478 ~ 33624754 (-)
G1283653 NA non-coding downstream 44137 33600478 ~ 33600737 (-)
G1283497 NA non-coding downstream 153044 33491610 ~ 33491830 (-)
G1283730 NA non-coding upstream 1485 33647016 ~ 33647228 (-)
G1283732 NA non-coding upstream 2557 33648088 ~ 33648309 (-)
G1283851 NA non-coding upstream 11031 33656562 ~ 33660170 (-)
G1284008 NA non-coding upstream 216484 33862015 ~ 33862218 (-)
G1284034 NA non-coding upstream 246721 33892252 ~ 33892490 (-)
G1283257 NA other downstream 378656 33262580 ~ 33266218 (-)
G1282159 LOC106590060 other downstream 1166358 32475919 ~ 32478516 (-)
G1281363 NA other downstream 1778737 31865289 ~ 31866137 (-)
G1281361 NA other downstream 1780238 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 3656358 29979175 ~ 30253803 (-)
G1285645 NA other upstream 1339322 34984853 ~ 34985274 (-)
G1287067 NA other upstream 2512905 36158436 ~ 36158733 (-)
G1288280 NA other upstream 3593643 37239174 ~ 37239410 (-)
G1288297 NA other upstream 3615484 37261015 ~ 37261648 (-)
G1289323 LOC106590025 other upstream 4364662 38010193 ~ 38011916 (-)

Expression

G1283727 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1283727 Expression in each Bioproject

Bar chart with 20 bars.
G1283727 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network