G1283986



Basic Information


Item Value
gene id G1283986
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 33847497 ~ 33847715 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1465914
cgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaaattcattctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcacgcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1465914 True 219 lncRNA 0.44 1 33847497 33847715

Neighbor


gene id symbol gene type direction distance location
LOC110490956 drosha coding upstream 585453 33099881 ~ 33262044 (+)
LOC110490013 LOC106590056 coding upstream 830540 33014206 ~ 33016968 (+)
LOC118938962 NA coding upstream 914647 32932796 ~ 32932850 (+)
LOC110490011 LOC106590060 coding upstream 1367508 32350805 ~ 32480547 (+)
LOC118938888 NA coding upstream 1835752 32008121 ~ 32011745 (+)
LOC110490016 LOC106590054 coding downstream 429306 34277021 ~ 34325910 (+)
LOC110490017 LOC106590053 coding downstream 776199 34623914 ~ 34822015 (+)
LOC110490018 LOC106578564 coding downstream 1144708 34992423 ~ 35361339 (+)
LOC118938916 NA coding downstream 1769109 35616824 ~ 35619520 (+)
LOC110490019 LOC106578561 coding downstream 1888667 35736382 ~ 35815615 (+)
G1283673 NA non-coding upstream 234497 33612796 ~ 33613000 (+)
G1283663 NA non-coding upstream 239568 33607684 ~ 33607929 (+)
G1283657 NA non-coding upstream 242347 33604908 ~ 33605150 (+)
G1283651 NA non-coding upstream 246753 33600438 ~ 33600744 (+)
G1283623 NA non-coding upstream 263961 33583332 ~ 33583536 (+)
G1284039 NA non-coding downstream 49088 33896803 ~ 33897203 (+)
G1284126 NA non-coding downstream 112564 33960279 ~ 33960651 (+)
G1284149 NA non-coding downstream 126580 33974295 ~ 33974838 (+)
G1284190 NA non-coding downstream 148608 33996323 ~ 33996653 (+)
G1284197 NA non-coding downstream 154229 34001944 ~ 34002145 (+)
G1282302 NA other upstream 1149461 32687558 ~ 32698036 (+)
G1281462 NA other upstream 1850984 31996167 ~ 31996513 (+)
G1279833 NA other upstream 2900167 30944171 ~ 30947330 (+)
htr5ab htr5a other upstream 3439480 30395817 ~ 30416375 (+)
G1279349 NA other upstream 3544078 30303033 ~ 30303419 (+)
G1284354 NA other downstream 264092 34111807 ~ 34112271 (+)
G1286648 LOC106590042 other downstream 2187868 36035583 ~ 36093396 (+)
G1287489 LOC106590045 other downstream 2661363 36509078 ~ 36510512 (+)
G1289491 NA other downstream 4335721 38183436 ~ 38184003 (+)
G1289710 NA other downstream 4747165 38594880 ~ 38600241 (+)

Expression


G1283986 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1283986 Expression in each Bioproject

Bar chart with 14 bars.
G1283986 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network