G1285041



Basic Information


Item Value
gene id G1285041
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 34586529 ~ 34586887 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1466987
atccagaagaagattgggagaatgtcatatggtcagatgaaaccaaaatataactttttgataaaaactcaactcgtcgtgtttggaagacaaagaataattgcatccaaataacaccatacctacagtgaagcatgggggtggaaacatcatgctttgggactgtttttctgcaaagggaccaggacgactgatccgtgtaaaggaaagaatgaatggggccatgtatcatgagattttgagtgaaaacctccttccattagcaagggcattgaagatgaaacgtggctgggtctttcagcatgacaatgatcccaaacacacctcccgggcaacgaaggagtggcttcgtaagaagc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1466987 True 359 lncRNA 0.43 1 34586529 34586887

Neighbor


gene id symbol gene type direction distance location
LOC110516899 LOC106595224 coding downstream 680262 33903944 ~ 33906267 (-)
LOC110490014 LOC106590055 coding downstream 1237815 33267004 ~ 33348714 (-)
LOC118938795 NA coding downstream 1291936 33291229 ~ 33294593 (-)
LOC110490012 LOC106590058 coding downstream 1906682 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 2300309 32120931 ~ 32286220 (-)
LOC118938915 NA coding upstream 324348 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 1451891 36038778 ~ 36142327 (-)
LOC110490717 LOC106590044 coding upstream 1728551 36315438 ~ 36462331 (-)
LOC110490025 LOC106590045 coding upstream 1917021 36503908 ~ 36545570 (-)
LOC110490027 NA coding upstream 2008431 36595318 ~ 36610151 (-)
G1285034 NA non-coding downstream 5478 34580852 ~ 34581051 (-)
G1284989 NA non-coding downstream 34765 34551452 ~ 34551764 (-)
G1284967 NA non-coding downstream 52782 34533406 ~ 34533747 (-)
G1284963 NA non-coding downstream 54954 34531262 ~ 34531575 (-)
G1284778 NA non-coding downstream 184630 34401667 ~ 34401899 (-)
G1285043 NA non-coding upstream 88 34586975 ~ 34587401 (-)
G1285395 NA non-coding upstream 178366 34765253 ~ 34784030 (-)
G1285480 NA non-coding upstream 278866 34865753 ~ 34866016 (-)
G1285539 NA non-coding upstream 323182 34910069 ~ 34910337 (-)
G1285546 NA non-coding upstream 329849 34916736 ~ 34916950 (-)
G1283257 NA other downstream 1320311 33262580 ~ 33266218 (-)
G1282159 LOC106590060 other downstream 2108013 32475919 ~ 32478516 (-)
G1281363 NA other downstream 2720392 31865289 ~ 31866137 (-)
G1281361 NA other downstream 2721893 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 4598013 29979175 ~ 30253803 (-)
G1285645 NA other upstream 397966 34984853 ~ 34985274 (-)
G1287067 NA other upstream 1571549 36158436 ~ 36158733 (-)
G1288280 NA other upstream 2652287 37239174 ~ 37239410 (-)
G1288297 NA other upstream 2674128 37261015 ~ 37261648 (-)
G1289323 LOC106590025 other upstream 3423306 38010193 ~ 38011916 (-)

Expression


G1285041 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1285041 Expression in each Bioproject

Bar chart with 13 bars.
G1285041 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 15.
End of interactive chart.

Co-expression Network