G1285539



Basic Information


Item Value
gene id G1285539
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 34910069 ~ 34910337 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1467507
AGACTAAGCAATGCCTCCTAACGCAGATCTTCATTGACAGGAACTTCTTAGTCTAAGTCTAGGCTTCATCTCTGACGGTGTAACCGGCATGCTGTGTGTCACAAACAGCTGACTTTTCACCCTACACTCAAACTGTGTGGTTTCTAATTTTTCCTCATGGACCTGTAGCAGCAAGCCCTTTTGCTGACCTCTCTGGTTACTTTGTCCCTGTTCGAAACGGTTTTGAATAAAAATAATGAGCAATCATTCCTGGCCAGACAATGTACATC

Function


NR:

description
uncharacterized protein LOC111188275

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1467507 True 269 lncRNA 0.44 1 34910069 34910337
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110516899 LOC106595224 coding downstream 1003802 33903944 ~ 33906267 (-)
LOC110490014 LOC106590055 coding downstream 1561355 33267004 ~ 33348714 (-)
LOC118938795 NA coding downstream 1615476 33291229 ~ 33294593 (-)
LOC110490012 LOC106590058 coding downstream 2230222 32557738 ~ 32679847 (-)
sugct LOC106590081 coding downstream 2623849 32120931 ~ 32286220 (-)
LOC118938915 NA coding upstream 898 34911235 ~ 34912329 (-)
LOC110490023 LOC106590042 coding upstream 1128441 36038778 ~ 36142327 (-)
LOC110490717 LOC106590044 coding upstream 1405101 36315438 ~ 36462331 (-)
LOC110490025 LOC106590045 coding upstream 1593571 36503908 ~ 36545570 (-)
LOC110490027 NA coding upstream 1684981 36595318 ~ 36610151 (-)
G1285480 NA non-coding downstream 44053 34865753 ~ 34866016 (-)
G1285395 NA non-coding downstream 126039 34765253 ~ 34784030 (-)
G1285043 NA non-coding downstream 322668 34586975 ~ 34587401 (-)
G1285041 NA non-coding downstream 323182 34586529 ~ 34586887 (-)
G1285034 NA non-coding downstream 329018 34580852 ~ 34581051 (-)
G1285546 NA non-coding upstream 6399 34916736 ~ 34916950 (-)
G1285554 NA non-coding upstream 12052 34922389 ~ 34923087 (-)
G1285633 NA non-coding upstream 69421 34979758 ~ 34980088 (-)
G1285634 NA non-coding upstream 69867 34980204 ~ 34980516 (-)
G1286390 NA non-coding upstream 648336 35558673 ~ 35559149 (-)
G1283257 NA other downstream 1643851 33262580 ~ 33266218 (-)
G1282159 LOC106590060 other downstream 2431553 32475919 ~ 32478516 (-)
G1281363 NA other downstream 3043932 31865289 ~ 31866137 (-)
G1281361 NA other downstream 3045433 31864234 ~ 31864636 (-)
dlgap1b LOC106590111 other downstream 4921553 29979175 ~ 30253803 (-)
G1285645 NA other upstream 74516 34984853 ~ 34985274 (-)
G1287067 NA other upstream 1248099 36158436 ~ 36158733 (-)
G1288280 NA other upstream 2328837 37239174 ~ 37239410 (-)
G1288297 NA other upstream 2350678 37261015 ~ 37261648 (-)
G1289323 LOC106590025 other upstream 3099856 38010193 ~ 38011916 (-)

Expression


G1285539 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1285539 Expression in each Bioproject

Bar chart with 18 bars.
G1285539 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network