G1290614


Basic Information

Item Value
gene id G1290614
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 39126272 ~ 39127009 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1472866
tcatagaccttgccaaggctttcgactctgtcaatcaccgtattcttatcggcagactcagtagcctcggtttttcggatgactgccttgcctggttcaccaattactttgcagacagagttcagtgtgtcaaatcggagggcatgctgtccggtcctctggcagtctctatgggggtgccacagggttcaattcccgggccgactcttttctctgtatatatcaatgatgtttctcatgctgcgggcgattccctgatccacctctacgcagacgacaccattctatatacttccggcccgtccttggacactgtgctatctaacctccaaacgagcttcaatgccatacagcactccttccgtggcctccaactgctcttaaacgctagtaaaaccaaatgcatgcttttcaaccgttcgctgcctgcacccgcacgcctgaccagcatcaccaccctggatggttccgaccttgaatatgtggacatctataagtacctaggtgtctggctagactctaaactctccttccagacccatatcaaacatctccaatcgaaaatcaaatcaagagttggctttctattccgcaacaaagcctccttcactcacgccgccaaacttaccctagtaaaactgactatcctaccgatcctcgacttcggcgatgtcatctacaaaattgcttccaacactctactcagcaaactggatgcagtttatcacagtgccatcc

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1472866 True 738 TUCP 0.49 1 39126272 39127009
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110490841 NA coding upstream 36636 39086859 ~ 39089636 (+)
LOC110490726 LOC106600248 coding upstream 41572 39082814 ~ 39084700 (+)
LOC110490723 LOC106612786 coding upstream 270164 38855250 ~ 38856108 (+)
LOC110490039 LOC106590018 coding upstream 545516 38576635 ~ 38580756 (+)
LOC110490038 LOC106590019 coding upstream 557793 38494289 ~ 38568479 (+)
brca2 NA coding downstream 420335 39547344 ~ 39589108 (+)
LOC110490049 LOC106612364 coding downstream 522361 39649370 ~ 39684044 (+)
LOC110490050 LOC106612350 coding downstream 785433 39845713 ~ 39929225 (+)
LOC110490053 fgf12 coding downstream 809877 39936886 ~ 40053076 (+)
LOC110490048 il-1racp coding downstream 962455 40089464 ~ 40132600 (+)
G1290613 NA non-coding upstream 3199 39122681 ~ 39123073 (+)
G1290549 LOC106590036 non-coding upstream 65024 39037005 ~ 39061248 (+)
G1290550 zc3hf non-coding upstream 92852 39027242 ~ 39033420 (+)
G1290559 NA non-coding upstream 95642 39024349 ~ 39030630 (+)
G1290619 NA non-coding downstream 9782 39136791 ~ 39166202 (+)
G1290623 NA non-coding downstream 54227 39181236 ~ 39184267 (+)
G1290624 NA non-coding downstream 59453 39186462 ~ 39224019 (+)
G1290620 NA non-coding downstream 61177 39188186 ~ 39279823 (+)
G1290636 NA non-coding downstream 62473 39189482 ~ 39212790 (+)
G1289710 NA other upstream 526031 38594880 ~ 38600241 (+)
G1289491 NA other upstream 942269 38183436 ~ 38184003 (+)
G1287489 LOC106590045 other upstream 2615760 36509078 ~ 36510512 (+)
G1286648 LOC106590042 other upstream 3032876 36035583 ~ 36093396 (+)
G1291464 NA other downstream 940549 40067558 ~ 40067907 (+)
G1293072 NA other downstream 2456364 41583216 ~ 41589030 (+)
G1293295 NA other downstream 2782025 41909034 ~ 41909611 (+)
G1294319 NA other downstream 3637844 42764853 ~ 42767937 (+)

Expression

G1290614 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1290614 Expression in each Bioproject

Bar chart with 20 bars.
G1290614 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network