G1292175



Basic Information


Item Value
gene id G1292175
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 40640247 ~ 40640490 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1474632
acatacatgtattgtgtaacatgaagtcctatgagtgtcatctgcggaagatcaaaggttagtgattcatttagtctctatttgtgctttttgtgactcctctttggctggaaaaatggctgggtttttctgtgagttggtcatcacctaacaatcgtttgtggtgctttcgctgtaaagcctatttgaaatcggacactgttgtgggattaacaacaagattacctttaaaacggtataaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1474632 True 244 lncRNA 0.38 1 40640247 40640490
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490048 il-1racp coding upstream 507647 40089464 ~ 40132600 (+)
LOC110490053 fgf12 coding upstream 587171 39936886 ~ 40053076 (+)
LOC110490050 LOC106612350 coding upstream 711022 39845713 ~ 39929225 (+)
LOC110490049 LOC106612364 coding upstream 956203 39649370 ~ 39684044 (+)
brca2 NA coding upstream 1051139 39547344 ~ 39589108 (+)
tfdp2 LOC105026801 coding downstream 389886 41030376 ~ 41088538 (+)
LOC110490065 LOC106580667 coding downstream 453040 41093530 ~ 41156857 (+)
trnap-ugg-11 NA coding downstream 596496 41236986 ~ 41237057 (+)
trnap-ugg-12 NA coding downstream 598366 41238856 ~ 41238927 (+)
trnap-ugg-13 NA coding downstream 599301 41239791 ~ 41239862 (+)
G1292172 NA non-coding upstream 1640 40638378 ~ 40638607 (+)
G1292171 NA non-coding upstream 4594 40635443 ~ 40635653 (+)
G1292170 NA non-coding upstream 6818 40633181 ~ 40633429 (+)
G1292168 NA non-coding upstream 8959 40631069 ~ 40631288 (+)
G1292165 NA non-coding upstream 11086 40628919 ~ 40629161 (+)
G1292178 NA non-coding downstream 3724 40644214 ~ 40644468 (+)
G1292181 NA non-coding downstream 6167 40646657 ~ 40646910 (+)
G1292182 NA non-coding downstream 7036 40647526 ~ 40647887 (+)
G1292184 NA non-coding downstream 9886 40650376 ~ 40650583 (+)
G1292185 NA non-coding downstream 12022 40652512 ~ 40652854 (+)
G1291464 NA other upstream 572340 40067558 ~ 40067907 (+)
G1290614 NA other upstream 1513238 39126272 ~ 39127009 (+)
G1290549 LOC106590036 other upstream 1602588 39037005 ~ 39061248 (+)
G1289710 NA other upstream 2040006 38594880 ~ 38600241 (+)
G1293072 NA other downstream 942883 41583216 ~ 41589030 (+)
G1293295 NA other downstream 1268544 41909034 ~ 41909611 (+)
G1294319 NA other downstream 2124363 42764853 ~ 42767937 (+)
G1295348 LOC106602853 other downstream 2956434 43596924 ~ 43597464 (+)
G1295730 NA other downstream 3275688 43916178 ~ 43916479 (+)

Expression


G1292175 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1292175 Expression in each Bioproject

Bar chart with 20 bars.
G1292175 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network