G1293056



Basic Information


Item Value
gene id G1293056
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 41553534 ~ 41553948 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1475580
gtgtagccatcttcatcgacctggccaaggctttcgactctgtcaatcaccatattcttatcggcagactcaaaagccttgatttctcaaatgactgcctcgcctggttcaccaactacttcgcagacagagttcaatgtgtaaaatcggagggcctgttttccggacctctggcagtctctatgggggtaccacagggttcaattctcgggccgactcttttctctgtatatatcaacaatgtcgctcttgctgcgggtgattccctgatccacctctatgcagacgacaccattctgtatacatctggcccttctttggacactgtgttaactaacctccaaacgagcttcaatgccatacaacactccttctgtggcctccaactgctcttaaacgctagcaaaaccaaatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1475580 True 415 lncRNA 0.48 1 41553534 41553948
Loading

Neighbor


gene id symbol gene type direction distance location
trnap-cgg-207 NA coding upstream 16039 41537424 ~ 41537495 (+)
trnap-cgg-206 NA coding upstream 17842 41535621 ~ 41535692 (+)
trnap-cgg-205 NA coding upstream 19693 41533280 ~ 41533841 (+)
trnap-cgg-204 NA coding upstream 25833 41527630 ~ 41527701 (+)
trnap-cgg-203 NA coding upstream 28501 41524962 ~ 41525033 (+)
LOC110490071 clrn1 coding downstream 3700 41557648 ~ 41567851 (+)
LOC110490073 NA coding downstream 29387 41583335 ~ 41588120 (+)
LOC110490072 LOC106612410 coding downstream 34515 41588463 ~ 41625040 (+)
iqcg iqcg coding downstream 256295 41810243 ~ 41836130 (+)
LOC110490081 LOC106580643 coding downstream 371226 41925174 ~ 41951832 (+)
G1293045 NA non-coding upstream 7912 41544898 ~ 41545622 (+)
G1293027 NA non-coding upstream 23707 41529167 ~ 41529827 (+)
G1293025 NA non-coding upstream 24476 41528470 ~ 41529058 (+)
G1293020 NA non-coding upstream 40593 41512075 ~ 41512941 (+)
G1293084 NA non-coding downstream 23881 41577829 ~ 41578216 (+)
G1293072 NA non-coding downstream 29268 41583216 ~ 41589030 (+)
G1293089 NA non-coding downstream 38070 41592018 ~ 41592641 (+)
G1293079 NA non-coding downstream 56185 41610133 ~ 41610840 (+)
G1293074 NA non-coding downstream 71113 41625061 ~ 41626045 (+)
LOC110490048 il-1racp other upstream 1422800 40089464 ~ 40132600 (+)
G1291464 NA other upstream 1485627 40067558 ~ 40067907 (+)
G1290614 NA other upstream 2426525 39126272 ~ 39127009 (+)
G1290549 LOC106590036 other upstream 2515875 39037005 ~ 39061248 (+)
G1289710 NA other upstream 2953293 38594880 ~ 38600241 (+)
G1293295 NA other downstream 355086 41909034 ~ 41909611 (+)
G1294319 NA other downstream 1210905 42764853 ~ 42767937 (+)
G1295348 LOC106602853 other downstream 2042976 43596924 ~ 43597464 (+)
G1295730 NA other downstream 2362230 43916178 ~ 43916479 (+)

Expression


G1293056 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1293056 Expression in each Bioproject

Bar chart with 20 bars.
G1293056 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network