XLOC_031952 (pimr8)


Basic Information

Item Value
gene id XLOC_031952
gene name pimr8
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 16982613 ~ 16983924 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00062539
aggttggaggagattgtccatgtcccacatgggtgaagaaagaggagaagatacacgggacggcaccactgagcttcctggttttttggctcctgtgccttcacatttggctgattctgcatccacagaccagaggaacagcaagaggaaaaggcagagcagcagccagcaaacactgtccacctcgtccagcagaccagccaaacgctctcgcagagacttgtaccagaagggcccgttgctgggacggggtggattcggctctgtgtttgctgggatgcgcaggtctgatggactgccagtggccatcaagtatgtgtcgaaggaccggacccccgagcgactgaaagttgatggtcagggtcggctgccgctggaggtggcattgatgacccgtgtcacgtcagctcctgcctgccccagtgtcctgcagctgctggactggtttgaccgtcccagacgctacatcctgatcctggagcgaccggatccttgccaagatctccagagcttctgtgaggagaacggctgtctggatgagcgtctggccaagaaagtgctggtgcagctgatcgcggccctaaaacactgcgagagccgcggcgtcctgcatcgggacgtcaaaccagaaaacctgctgatctccacagagtcccaggacatcaagctgctggacttcggctgtggagatctgctgaagcgctcggcctacaaatactttgcaggcactcctgcatacgctcctcccga

Function

symbol description
pimr8 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000110631

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00062539 True 750 mRNA 0.58 6 16982613 16983924

Neighbor

gene id symbol gene type direction distance location
XLOC_031951 pimr13 coding upstream 31453 16949735 ~ 16951160 (+)
XLOC_031950 pimr28 coding upstream 85619 16895685 ~ 16896994 (+)
XLOC_031949 pimr21 coding upstream 111291 16870004 ~ 16871322 (+)
XLOC_031948 NA coding upstream 173387 16799202 ~ 16809226 (+)
XLOC_031947 pimr12 coding upstream 245005 16736871 ~ 16737608 (+)
XLOC_031953 BX511311.5 coding downstream 67115 17051039 ~ 17051135 (+)
XLOC_031954 pimr16 coding downstream 69726 17053650 ~ 17054966 (+)
XLOC_031955 NA coding downstream 74268 17058192 ~ 17274417 (+)
XLOC_031956 pimr5 coding downstream 129753 17113677 ~ 17114993 (+)
XLOC_031957 pimr4 coding downstream 197233 17181157 ~ 17182473 (+)
XLOC_031945 NA non-coding upstream 307929 16591985 ~ 16674684 (+)
XLOC_031946 NA non-coding upstream 313467 16667458 ~ 16669146 (+)
XLOC_031941 NA non-coding upstream 585088 16394629 ~ 16397525 (+)
XLOC_031939 NA non-coding upstream 988649 15990935 ~ 15993964 (+)
XLOC_031958 BX511311.8 non-coding downstream 221268 17205192 ~ 17205289 (+)
XLOC_031961 CABZ01041996.1 non-coding downstream 333633 17317557 ~ 17317653 (+)
XLOC_031962 BX470083.5 non-coding downstream 397561 17381485 ~ 17381582 (+)

Expression


Co-expression Network