G1295845



Basic Information


Item Value
gene id G1295845
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 44029436 ~ 44029861 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1478633
ctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaaaagtggcaagaagaaagccatttcttaaagatatccataaaaagtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttctggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagac

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1478633 True 426 TUCP 0.45 1 44029436 44029861

Neighbor


gene id symbol gene type direction distance location
nipsnap2 nips2 coding upstream 4853 44005413 ~ 44024583 (+)
mrps17 mrps17 coding upstream 29505 43998013 ~ 43999931 (+)
mntb LOC106602836 coding upstream 311090 43698455 ~ 43718346 (+)
LOC110490730 NA coding upstream 331618 43696212 ~ 43697965 (+)
LOC110490107 lis1b coding upstream 337422 43641381 ~ 43692014 (+)
cblb cblb coding downstream 143491 44173352 ~ 44326246 (+)
LOC110490121 LOC106602827 coding downstream 556424 44586285 ~ 44603799 (+)
LOC110490732 LOC106602993 coding downstream 616932 44646793 ~ 44648830 (+)
cldn2 cldn7 coding downstream 689439 44719300 ~ 44721744 (+)
LOC110490127 LOC106602822 coding downstream 705899 44735760 ~ 44848514 (+)
G1295843 NA non-coding upstream 1558 44027587 ~ 44027878 (+)
G1295789 NA non-coding upstream 67139 43961985 ~ 43962297 (+)
G1295788 NA non-coding upstream 68539 43960438 ~ 43960897 (+)
G1295787 NA non-coding upstream 69830 43959399 ~ 43959606 (+)
G1295775 NA non-coding upstream 80036 43949184 ~ 43949400 (+)
G1295849 NA non-coding downstream 7529 44037390 ~ 44037673 (+)
G1295872 NA non-coding downstream 41125 44070986 ~ 44123435 (+)
G1295887 cfap54 non-coding downstream 64941 44094802 ~ 44095443 (+)
G1296030 NA non-coding downstream 122834 44152695 ~ 44153020 (+)
G1296051 NA non-coding downstream 138227 44168088 ~ 44168835 (+)
G1295730 NA other upstream 112957 43916178 ~ 43916479 (+)
G1295348 LOC106602853 other upstream 431972 43596924 ~ 43597464 (+)
G1294319 NA other upstream 1261499 42764853 ~ 42767937 (+)
G1293295 NA other upstream 2119825 41909034 ~ 41909611 (+)
G1293072 NA other upstream 2441292 41583216 ~ 41589030 (+)
G1296266 LOC106602826 other downstream 517318 44547179 ~ 44581048 (+)
G1296185 NA other downstream 619840 44649701 ~ 44652079 (+)
G1298452 NA other downstream 2224478 46254339 ~ 46260437 (+)
brd1a LOC106575995 other downstream 2284391 46293582 ~ 46316075 (+)

Expression


G1295845 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1295845 Expression in each Bioproject

Bar chart with 19 bars.
G1295845 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network