G1298177



Basic Information


Item Value
gene id G1298177
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 45956059 ~ 45989263 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1481228
gaccattctggaagaaaacctgatggagtctgcagaagacctgagactgggatggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaagctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcaatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaagaatacagttttatatctttatgtttgaagcctgaaatgtggcaaaaggtcgcaaagtt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1481228 True 555 TUCP 0.39 2 45956059 45989263
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490153 LOC106575999 coding downstream 66670 45828313 ~ 45889389 (-)
LOC110490151 NA coding downstream 238917 45715991 ~ 45717142 (-)
LOC110490145 LOC106575954 coding downstream 286919 45656855 ~ 45669140 (-)
atxn10 atxn10 coding downstream 345893 45597961 ~ 45610166 (-)
LOC110490142 NA coding downstream 403509 45518126 ~ 45552550 (-)
creld2 LOC106575997 coding upstream 265074 46254337 ~ 46260490 (-)
zbed4 LOC106575996 coding upstream 279727 46268990 ~ 46275662 (-)
LOC110490845 NA coding upstream 728727 46717990 ~ 46719108 (-)
tafa5a fam19a5 coding upstream 832993 46822067 ~ 46995100 (-)
tbc1d22a tbc1d22a coding upstream 1228269 47217532 ~ 47405004 (-)
G1298138 NA non-coding downstream 44160 45894507 ~ 45911899 (-)
G1298096 NA non-coding downstream 124974 45825201 ~ 45831085 (-)
G1297967 NA non-coding downstream 320867 45629928 ~ 45635192 (-)
G1298245 NA non-coding upstream 66744 46056007 ~ 46083653 (-)
G1298274 NA non-coding upstream 113288 46102551 ~ 46102791 (-)
G1298290 NA non-coding upstream 123955 46113218 ~ 46113418 (-)
G1298303 NA non-coding upstream 130886 46120149 ~ 46120425 (-)
G1298336 NA non-coding upstream 156659 46145922 ~ 46146135 (-)
G1298047 kdm5a other downstream 193674 45752061 ~ 45762385 (-)
G1297577 NA other downstream 452947 45495755 ~ 45503112 (-)
cdpf1 cdpf1 other downstream 474288 45472681 ~ 45481816 (-)
G1297112 NA other downstream 1001150 44949380 ~ 44954909 (-)
G1297069 NA other downstream 1079289 44861404 ~ 44876770 (-)
G1298541 LOC106575995 other upstream 307805 46295361 ~ 46297952 (-)
celsr1a LOC106576003 other upstream 1663247 47584674 ~ 47707520 (-)
si:dkeyp-27e10.3 LOC106576037 other upstream 2846331 48822973 ~ 48839311 (-)

Expression


G1298177 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1298177 Expression in each Bioproject

Bar chart with 20 bars.
G1298177 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network