G1299296



Basic Information


Item Value
gene id G1299296
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 46992500 ~ 46993943 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1482428
GGGAAGAGTGCAGGAGAAACAGGTGAAGGTGGACAGGAGAGTAGGGTAGAGGCAGCCTAGGACGAGAGAGACGGGACTGGACAGGAAACGGGAAAGGACAGACAAGAGGGACAAGCCAGGACAAGGAAAGGGACAGCGGAAGGAGTCAGACCATGGTAGAAAAGACAAGCCAGGAGGGAAGAAATGGACAAAAAAGGGTGATGGTACTGAAGTAAGCCGCCAACTTGACAATTCCACACATCCAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1482428 True 246 lncRNA 0.52 2 46992500 46993943
Loading

Neighbor


gene id symbol gene type direction distance location
brd1a LOC106575995 coding upstream 676425 46293582 ~ 46316075 (+)
alg12 alg12 coding upstream 723767 46260593 ~ 46268733 (+)
LOC110490155 pim3 coding upstream 819683 46168371 ~ 46172817 (+)
il17rel LOC106575998 coding upstream 1053695 45902083 ~ 45938805 (+)
LOC110490152 LOC106575950 coding upstream 1161411 45790639 ~ 45831089 (+)
cerk LOC106575992 coding downstream 418494 47412437 ~ 47443051 (+)
srr LOC106575990 coding downstream 724975 47717685 ~ 47723038 (+)
alg10 LOC106575988 coding downstream 739576 47733519 ~ 47736943 (+)
LOC110490177 NA coding downstream 1005185 47999128 ~ 48001885 (+)
LOC110490734 LOC106576001 coding downstream 1124831 48118774 ~ 48146269 (+)
G1299145 NA non-coding upstream 98800 46764574 ~ 46893700 (+)
G1299211 NA non-coding upstream 123811 46863411 ~ 46868689 (+)
G1299077 NA non-coding upstream 268442 46723785 ~ 46724058 (+)
G1299042 NA non-coding upstream 292037 46700237 ~ 46700463 (+)
G1299023 NA non-coding upstream 306111 46686160 ~ 46686389 (+)
G1299626 NA non-coding downstream 141034 47134977 ~ 47135571 (+)
G1299666 NA non-coding downstream 203437 47197380 ~ 47197611 (+)
G1299679 NA non-coding downstream 219848 47213791 ~ 47214027 (+)
G1299682 NA non-coding downstream 221745 47215688 ~ 47215891 (+)
G1299683 NA non-coding downstream 222816 47216759 ~ 47217073 (+)
G1298452 NA other upstream 732063 46254339 ~ 46260437 (+)
G1296185 NA other upstream 2340421 44649701 ~ 44652079 (+)
G1296266 LOC106602826 other upstream 2411452 44547179 ~ 44581048 (+)
cblb cblb other upstream 2666321 44173352 ~ 44326246 (+)
G1299894 NA other downstream 575887 47569830 ~ 47570663 (+)
G1300598 LOC106575986 other downstream 952425 47946368 ~ 47947892 (+)
kiss2 kiss2 other downstream 1365885 48359799 ~ 48360553 (+)
G1301200 NA other downstream 1590764 48584707 ~ 48585263 (+)
G1301458 NA other downstream 1936103 48930046 ~ 48930588 (+)

Expression


G1299296 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1299296 Expression in each Bioproject

Bar chart with 5 bars.
G1299296 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network