G1299894



Basic Information


Item Value
gene id G1299894
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 47569830 ~ 47570663 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1483075
gaggttatatacagggtattatggtacagagtcaatgtggagactatatacagggtattatggtacagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggaggctatatacagggtattacggtacagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggagactatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtactggtacagagtcaatgtggagactatatacagggggtactggtacagagtcaatgtcaccggttagttgaggtacttgaggtaatatgtacatgtaggtagagttagtgac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1483075 True 366 TUCP 0.45 3 47569830 47570663
Loading

Neighbor


gene id symbol gene type direction distance location
cerk LOC106575992 coding upstream 126779 47412437 ~ 47443051 (+)
brd1a LOC106575995 coding upstream 1253755 46293582 ~ 46316075 (+)
alg12 alg12 coding upstream 1301097 46260593 ~ 46268733 (+)
LOC110490155 pim3 coding upstream 1397013 46168371 ~ 46172817 (+)
il17rel LOC106575998 coding upstream 1631025 45902083 ~ 45938805 (+)
srr LOC106575990 coding downstream 148255 47717685 ~ 47723038 (+)
alg10 LOC106575988 coding downstream 162856 47733519 ~ 47736943 (+)
LOC110490177 NA coding downstream 428465 47999128 ~ 48001885 (+)
LOC110490734 LOC106576001 coding downstream 548111 48118774 ~ 48146269 (+)
slco1d1 LOC106575962 coding downstream 576409 48147072 ~ 48161884 (+)
G1299893 NA non-coding upstream 1011 47568534 ~ 47568819 (+)
G1299840 NA non-coding upstream 74029 47492786 ~ 47495801 (+)
G1299825 NA non-coding upstream 132275 47429613 ~ 47437555 (+)
G1299822 NA non-coding upstream 143972 47425647 ~ 47425858 (+)
G1299821 NA non-coding upstream 145241 47424368 ~ 47424589 (+)
G1300334 LOC105030512 non-coding downstream 166718 47737381 ~ 47737608 (+)
G1300346 NA non-coding downstream 187421 47758084 ~ 47758394 (+)
G1300348 NA non-coding downstream 191606 47762269 ~ 47762483 (+)
G1300363 NA non-coding downstream 216322 47786985 ~ 47787191 (+)
G1298452 NA other upstream 1309393 46254339 ~ 46260437 (+)
G1296185 NA other upstream 2917751 44649701 ~ 44652079 (+)
G1296266 LOC106602826 other upstream 2988782 44547179 ~ 44581048 (+)
cblb cblb other upstream 3243651 44173352 ~ 44326246 (+)
G1300598 LOC106575986 other downstream 375705 47946368 ~ 47947892 (+)
kiss2 kiss2 other downstream 789165 48359799 ~ 48360553 (+)
G1301200 NA other downstream 1014044 48584707 ~ 48585263 (+)
G1301458 NA other downstream 1359383 48930046 ~ 48930588 (+)
G1301706 NA other downstream 1824560 49395223 ~ 49396921 (+)

Expression


G1299894 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1299894 Expression in each Bioproject

Bar chart with 20 bars.
G1299894 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network