G1300774



Basic Information


Item Value
gene id G1300774
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 47963787 ~ 47988647 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1484066
ctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgaaattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttcaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttccca

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1484066 True 356 lncRNA 0.43 2 47963787 47988647
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490170 LOC106575987 coding downstream 41412 47805327 ~ 47922375 (-)
tprkb tprkb coding downstream 230346 47727999 ~ 47733441 (-)
trmu trmu coding downstream 244240 47710194 ~ 47719547 (-)
celsr1a LOC106576003 coding downstream 256267 47584674 ~ 47707520 (-)
gramd4a LOC106575991 coding downstream 404740 47492755 ~ 47559047 (-)
LOC110490175 LOC106575984 coding upstream 13231 48001878 ~ 48103308 (-)
LOC118938803 NA coding upstream 153518 48142165 ~ 48148218 (-)
LOC118938804 NA coding upstream 190631 48179278 ~ 48180941 (-)
LOC118938806 LOC106568775 coding upstream 203920 48192567 ~ 48193854 (-)
LOC118938807 LOC106590944 coding upstream 209796 48198443 ~ 48198934 (-)
G1300481 NA non-coding downstream 158535 47804201 ~ 47805252 (-)
G1300479 NA non-coding downstream 159829 47800829 ~ 47803958 (-)
G1300527 NA non-coding downstream 163568 47799939 ~ 47800219 (-)
G1300526 NA non-coding downstream 164595 47798939 ~ 47799192 (-)
G1300525 NA non-coding downstream 164937 47798310 ~ 47798850 (-)
G1300791 NA non-coding upstream 8444 47997091 ~ 47997312 (-)
G1300792 NA non-coding upstream 8975 47997622 ~ 47997959 (-)
G1300793 NA non-coding upstream 9469 47998116 ~ 47998660 (-)
G1300794 NA non-coding upstream 10078 47998725 ~ 47999011 (-)
G1300766 NA non-coding upstream 10525 47999172 ~ 48000083 (-)
tbc1d22a tbc1d22a other downstream 744172 47217532 ~ 47405004 (-)
tafa5a fam19a5 other downstream 1010363 46822067 ~ 46995100 (-)
G1298541 LOC106575995 other downstream 1665835 46295361 ~ 46297952 (-)
G1298177 NA other downstream 1974524 45956059 ~ 45989263 (-)
si:dkeyp-27e10.3 LOC106576037 other upstream 846947 48822973 ~ 48839311 (-)
G1302602 NA other upstream 1675304 49663951 ~ 49664296 (-)
LOC110490244 LOC106609225 other upstream 2310817 50290050 ~ 50301082 (-)
LOC110490264 LOC106576080 other upstream 3210582 51199223 ~ 51205927 (-)
LOC110490744 LOC106576129 other upstream 3797984 51785488 ~ 51793354 (-)

Expression


G1300774 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1300774 Expression in each Bioproject

Bar chart with 20 bars.
G1300774 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network