G1300850



Basic Information


Item Value
gene id G1300850
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 48108085 ~ 48108301 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1484146
gaggaggaggtgtattggtggaggaggaggtgttagggtgtgggggtgctttgctagttcgtgatttatttagaattcaaggcacacttaaccagcatggctatcacagcattctgcagtgatacgccatcccatctggtttgcgcttagtgggactgtcatttgtttttcaacaggacaatgacccaacacacctactggatgtgtaagggctatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1484146 True 217 lncRNA 0.47 1 48108085 48108301

Neighbor


gene id symbol gene type direction distance location
LOC110490175 LOC106575984 coding downstream 4777 48001878 ~ 48103308 (-)
LOC110490173 LOC106575983 coding downstream 111781 47975615 ~ 47996304 (-)
LOC110490171 NA coding downstream 133012 47933355 ~ 47975073 (-)
LOC110490170 LOC106575987 coding downstream 185710 47805327 ~ 47922375 (-)
tprkb tprkb coding downstream 374644 47727999 ~ 47733441 (-)
LOC118938803 NA coding upstream 33864 48142165 ~ 48148218 (-)
LOC118938804 NA coding upstream 70977 48179278 ~ 48180941 (-)
LOC118938806 LOC106568775 coding upstream 84266 48192567 ~ 48193854 (-)
LOC118938807 LOC106590944 coding upstream 90142 48198443 ~ 48198934 (-)
LOC118938808 NA coding upstream 91917 48200218 ~ 48201214 (-)
G1300814 NA non-coding downstream 63178 48042623 ~ 48044907 (-)
G1300766 NA non-coding downstream 108002 47999172 ~ 48000083 (-)
G1300794 NA non-coding downstream 109074 47998725 ~ 47999011 (-)
G1300793 NA non-coding downstream 109425 47998116 ~ 47998660 (-)
G1300792 NA non-coding downstream 110126 47997622 ~ 47997959 (-)
G1300858 NA non-coding upstream 10495 48118796 ~ 48120147 (-)
G1300860 LOC106591259 non-coding upstream 12701 48121002 ~ 48122073 (-)
G1300816 NA non-coding upstream 45665 48153966 ~ 48161890 (-)
G1300893 NA non-coding upstream 76071 48184372 ~ 48215172 (-)
celsr1a LOC106576003 other downstream 404047 47584674 ~ 47707520 (-)
tbc1d22a tbc1d22a other downstream 888470 47217532 ~ 47405004 (-)
tafa5a fam19a5 other downstream 1154661 46822067 ~ 46995100 (-)
G1298541 LOC106575995 other downstream 1810133 46295361 ~ 46297952 (-)
G1298177 NA other downstream 2118822 45956059 ~ 45989263 (-)
si:dkeyp-27e10.3 LOC106576037 other upstream 727293 48822973 ~ 48839311 (-)
G1302602 NA other upstream 1555650 49663951 ~ 49664296 (-)
LOC110490244 LOC106609225 other upstream 2191163 50290050 ~ 50301082 (-)
LOC110490264 LOC106576080 other upstream 3090928 51199223 ~ 51205927 (-)
LOC110490744 LOC106576129 other upstream 3678330 51785488 ~ 51793354 (-)

Expression


G1300850 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1300850 Expression in each Bioproject

Bar chart with 19 bars.
G1300850 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network