G1301162



Basic Information


Item Value
gene id G1301162
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 48519355 ~ 48519624 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1484516
GTTTAGAGGTATTCAAATTCATTGTGCAATGAAGATGGTGGTGCTATCCATACTACGTACATTGTGCGTTGCTGATCCATGCCTGTGCATCTTCAGCGTAATTAAACCACCTCAACTGGAATCCTACCTGCCTGTCATCTGTGCCCTTACCAGCACACGGGAGCGAACACATAAAGTAAAACCTAATCTGAAGAATATACAGTCCACCAAGTCCTCATTTACATAGGGGTCCGTTCGAGCCGGATAAAGATGTTTACTCCCGGTTCTAGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1484516 True 270 lncRNA 0.45 1 48519355 48519624

Neighbor


gene id symbol gene type direction distance location
LOC110490196 tnpo3 coding upstream 9523 48492575 ~ 48509832 (+)
LOC110490194 calu coding upstream 39478 48470021 ~ 48479877 (+)
LOC110490738 LOC106576023 coding upstream 77481 48433758 ~ 48441874 (+)
kiss2 kiss2 coding upstream 158802 48359799 ~ 48360553 (+)
LOC110490188 LOC106566434 coding upstream 181489 48336131 ~ 48337866 (+)
lamtor4 LOC106576032 coding downstream 230526 48750150 ~ 48752766 (+)
LOC110490204 LOC106576029 coding downstream 237581 48757205 ~ 48767893 (+)
LOC110490205 LOC106576033 coding downstream 255832 48775456 ~ 48783034 (+)
LOC110490215 LOC106576040 coding downstream 332955 48852579 ~ 48859532 (+)
LOC110490216 LOC106609152 coding downstream 435446 48955070 ~ 48957811 (+)
G1301144 NA non-coding upstream 28065 48491089 ~ 48491290 (+)
G1301140 NA non-coding upstream 30731 48488424 ~ 48488624 (+)
G1301014 NA non-coding upstream 52632 48466509 ~ 48466723 (+)
G1300990 lap2 non-coding upstream 119859 48398422 ~ 48399496 (+)
G1300983 NA non-coding upstream 133775 48385296 ~ 48385580 (+)
G1301164 NA non-coding downstream 1719 48521343 ~ 48521564 (+)
G1301167 NA non-coding downstream 4380 48524004 ~ 48524217 (+)
G1301169 NA non-coding downstream 7254 48526878 ~ 48527123 (+)
G1301173 NA non-coding downstream 10931 48530555 ~ 48530793 (+)
G1301178 NA non-coding downstream 18216 48537840 ~ 48538177 (+)
G1300598 LOC106575986 other upstream 571463 47946368 ~ 47947892 (+)
G1299894 NA other upstream 948692 47569830 ~ 47570663 (+)
brd1a LOC106575995 other upstream 2203353 46293582 ~ 46316075 (+)
G1298452 NA other upstream 2258918 46254339 ~ 46260437 (+)
G1301200 NA other downstream 65083 48584707 ~ 48585263 (+)
G1301458 NA other downstream 410422 48930046 ~ 48930588 (+)
G1301706 NA other downstream 875599 49395223 ~ 49396921 (+)
LOC110490228 NA other downstream 878834 49398275 ~ 49410313 (+)
G1303015 NA other downstream 1658650 50178274 ~ 50178565 (+)

Expression


G1301162 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1301162 Expression in each Bioproject

Bar chart with 14 bars.
G1301162 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network