G1304100



Basic Information


Item Value
gene id G1304100
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 51571430 ~ 51572011 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1487738
agcaagtgacgtcactgattgaaacgctatttagcgcccacgctaactaagctagccgtttcacatccgttacactcaccccccttttgaccttcctcctttttccgcagcaaccagtaatccgggtcaacagcatcaatgtaacagtataattttagaccgtcccctcgcccatacccgggcgcgaactagggaccttctgcacacatcaacagtcaccctcgaagcatcgttacccatcgctccacaaaagccgcggcccttgcagagcaaggggaactac

Function


NR:

description
PREDICTED: U3 small nucleolar ribonucleoprotein protein IMP4-like isoform X1

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1487738 True 283 lncRNA 0.53 2 51571430 51572011
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490271 LOC106576088 coding upstream 167029 51386269 ~ 51404401 (+)
atxn7l1 LOC106576087 coding upstream 188851 51351361 ~ 51382579 (+)
LOC118938813 NA coding upstream 205117 51364012 ~ 51366313 (+)
LOC110490270 LOC106576086 coding upstream 221584 51338069 ~ 51349846 (+)
LOC110490269 LOC106609207 coding upstream 247987 51304002 ~ 51323443 (+)
LOC110490274 LOC106576108 coding downstream 492868 52064879 ~ 52074544 (+)
LOC110490275 LOC106576109 coding downstream 550575 52122586 ~ 52126305 (+)
LOC110490276 LOC106576110 coding downstream 582144 52154155 ~ 52176143 (+)
LOC110490280 LOC106609195 coding downstream 632814 52204825 ~ 52207709 (+)
LOC110490279 LOC106576114 coding downstream 747611 52319622 ~ 52327848 (+)
G1303952 LOC106609208 non-coding upstream 270712 51300319 ~ 51300718 (+)
G1303951 LOC106609208 non-coding upstream 271222 51299940 ~ 51300208 (+)
G1303949 LOC106609208 non-coding upstream 272211 51298934 ~ 51299219 (+)
G1303946 LOC106609208 non-coding upstream 272708 51298389 ~ 51298722 (+)
G1304083 NA non-coding downstream 12743 51584754 ~ 51653000 (+)
G1304085 NA non-coding downstream 13109 51585120 ~ 51591050 (+)
G1304108 NA non-coding downstream 19974 51591985 ~ 51592397 (+)
G1304634 NA non-coding downstream 159087 51731098 ~ 51731322 (+)
G1304635 NA non-coding downstream 159828 51731839 ~ 51732077 (+)
G1303950 LOC106576084 other upstream 271669 51299403 ~ 51299761 (+)
G1303804 NA other upstream 498136 51071825 ~ 51073294 (+)
G1303641 NA other upstream 823715 50747362 ~ 50747715 (+)
G1304886 NA other downstream 342586 51914597 ~ 51915010 (+)
G1305302 NA other downstream 940618 52512629 ~ 52513050 (+)
sox5 LOC106576150 other downstream 1780606 53352462 ~ 53471763 (+)
G1306708 NA other downstream 2008530 53580541 ~ 53583352 (+)

Expression


G1304100 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

G1304100 Expression in each Bioproject

Bar chart with 14 bars.
G1304100 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network