G1304885



Basic Information


Item Value
gene id G1304885
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 51913650 ~ 51913897 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1488633
tacagtgccttgcgaaagtattcggcccccttgaactttgcaaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacaacatttattggatatttcaaacttttttaacaaatcaaaaactgaagaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1488633 True 248 lncRNA 0.37 1 51913650 51913897
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490742 LOC106609203 coding upstream 183116 51411245 ~ 51730534 (+)
LOC110490271 LOC106576088 coding upstream 509249 51386269 ~ 51404401 (+)
atxn7l1 LOC106576087 coding upstream 531071 51351361 ~ 51382579 (+)
LOC118938813 NA coding upstream 547337 51364012 ~ 51366313 (+)
LOC110490270 LOC106576086 coding upstream 563804 51338069 ~ 51349846 (+)
LOC110490274 LOC106576108 coding downstream 150982 52064879 ~ 52074544 (+)
LOC110490275 LOC106576109 coding downstream 208689 52122586 ~ 52126305 (+)
LOC110490276 LOC106576110 coding downstream 240258 52154155 ~ 52176143 (+)
LOC110490280 LOC106609195 coding downstream 290928 52204825 ~ 52207709 (+)
LOC110490279 LOC106576114 coding downstream 405725 52319622 ~ 52327848 (+)
G1304883 NA non-coding upstream 881 51912531 ~ 51912769 (+)
G1304874 NA non-coding upstream 6782 51906624 ~ 51906868 (+)
G1304700 NA non-coding upstream 95091 51786560 ~ 51818559 (+)
G1304677 NA non-coding upstream 153973 51759390 ~ 51759677 (+)
G1304668 NA non-coding upstream 159639 51753772 ~ 51754011 (+)
G1304895 LOC107662719 non-coding downstream 7451 51921348 ~ 51921987 (+)
G1304931 NA non-coding downstream 34335 51948232 ~ 51948480 (+)
G1304932 NA non-coding downstream 35692 51949589 ~ 51949789 (+)
G1305026 NA non-coding downstream 128639 52042536 ~ 52042765 (+)
G1305033 NA non-coding downstream 154831 52068728 ~ 52110046 (+)
G1304083 NA other upstream 260650 51584754 ~ 51653000 (+)
G1303950 LOC106576084 other upstream 613889 51299403 ~ 51299761 (+)
G1303804 NA other upstream 840356 51071825 ~ 51073294 (+)
G1304886 NA other downstream 700 51914597 ~ 51915010 (+)
G1305302 NA other downstream 598732 52512629 ~ 52513050 (+)
sox5 LOC106576150 other downstream 1438720 53352462 ~ 53471763 (+)
G1306708 NA other downstream 1666644 53580541 ~ 53583352 (+)
LOC110490314 LOC106576157 other downstream 1975331 53875911 ~ 53890829 (+)

Expression


G1304885 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1304885 Expression in each Bioproject

Bar chart with 18 bars.
G1304885 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network