G1307932



Basic Information


Item Value
gene id G1307932
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 54810762 ~ 54810983 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1492086
GCAGAAAACTGAGTGATTATTCATGTTGACCCAAATGAGAGGGATGTTTTCTCCGAATCAATGTAAACTCTGTAGTTGAGTTATGAGCAGTTTTTTGCCAAAGAGAAATTACCGATTGAAAACGTACATTTCATAGAGGGATGTTTTCTCCGAATCAAAGGCAATCAATGAAAATGATTTTGAACACAGTTTAACTACAAACAGAATGAAGTATGTATAGCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1492086 True 222 lncRNA 0.35 1 54810762 54810983

Neighbor


gene id symbol gene type direction distance location
LOC110490330 LOC106576173 coding upstream 411334 54383635 ~ 54399850 (+)
LOC110490325 LOC106576169 coding upstream 528975 54267330 ~ 54281787 (+)
LOC110490324 LOC106576203 coding upstream 546964 54256504 ~ 54263798 (+)
LOC110490323 LOC106576167 coding upstream 554396 54145538 ~ 54256366 (+)
LOC110490322 LOC106576166 coding upstream 693342 54104382 ~ 54117420 (+)
LOC118938814 NA coding downstream 206138 55016905 ~ 55018391 (+)
LOC118938895 NA coding downstream 212543 55023526 ~ 55030917 (+)
LOC110490334 LOC106609296 coding downstream 216688 55027671 ~ 55039809 (+)
LOC100272211 socs2 coding downstream 245869 55056852 ~ 55063742 (+)
LOC110490753 LOC106609289 coding downstream 301617 55112600 ~ 55137177 (+)
G1307927 NA non-coding upstream 795 54807679 ~ 54809967 (+)
G1307910 NA non-coding upstream 20410 54789736 ~ 54790352 (+)
G1307909 NA non-coding upstream 21354 54789067 ~ 54789408 (+)
G1307899 NA non-coding upstream 33805 54776725 ~ 54776957 (+)
G1307898 NA non-coding upstream 34554 54775863 ~ 54776208 (+)
G1307935 NA non-coding downstream 2094 54813077 ~ 54813367 (+)
G1307946 NA non-coding downstream 11648 54822631 ~ 54822925 (+)
G1307949 NA non-coding downstream 14055 54825038 ~ 54825242 (+)
G1307966 NA non-coding downstream 31980 54842963 ~ 54843328 (+)
G1307994 NA non-coding downstream 52344 54863327 ~ 54863576 (+)
LOC110490314 LOC106576157 other upstream 920371 53875911 ~ 53890829 (+)
G1306708 NA other upstream 1227410 53580541 ~ 53583352 (+)
sox5 LOC106576150 other upstream 1435350 53352462 ~ 53471763 (+)
G1305302 NA other upstream 2297712 52512629 ~ 52513050 (+)
G1304886 NA other upstream 2895752 51914597 ~ 51915010 (+)
LOC110490339 LOC106576184 other downstream 347023 55157706 ~ 55170847 (+)
G1308238 NA other downstream 451975 55262958 ~ 55278451 (+)
G1308299 LOC106576208 other downstream 537053 55348036 ~ 55349205 (+)
LOC110490357 LOC106609270 other downstream 759035 55569924 ~ 55583925 (+)
G1309147 NA other downstream 1205465 56016448 ~ 56016948 (+)

Expression


G1307932 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1307932 Expression in each Bioproject

Bar chart with 4 bars.
G1307932 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network