G1310105



Basic Information


Item Value
gene id G1310105
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 56704698 ~ 56704911 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1494599
GATGCATTCAGAAACAAGCATCAAATGGTTAATGTTCTAGATCCTCCCTAGGTTAATGTTCTAGATCATCTCTGTTAATGTTCTAGATCCTCCCTAGGTTAATTTTCTAGATCCTCCCTAGGTTAGTGTTCTAGATCATCTCTACGTTAATGTTCTAGATCCTCCCTAGGTTAATGTTCTAGATCCTCTCTAGGTTAGTGTTCTAGATCCCCCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1494599 True 214 lncRNA 0.40 1 56704698 56704911
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490369 LOC106576218 coding downstream 46649 56654750 ~ 56658049 (-)
LOC110490355 LOC106576199 coding downstream 1081049 55617681 ~ 55623649 (-)
LOC110490354 LOC106576197 coding downstream 1100229 55584646 ~ 55604469 (-)
LOC110490351 LOC106576194 coding downstream 1138588 55460350 ~ 55566110 (-)
LOC110490757 LOC106576193 coding downstream 1265745 55417169 ~ 55438953 (-)
LOC110490368 LOC106576221 coding upstream 6156 56711067 ~ 56776535 (-)
LOC110490364 LOC106576219 coding upstream 21400 56726311 ~ 56730594 (-)
LOC110490367 LOC106609343 coding upstream 27395 56732306 ~ 56734711 (-)
LOC118938817 NA coding upstream 74745 56779656 ~ 56782516 (-)
LOC110490365 LOC106576224 coding upstream 90439 56795350 ~ 56802777 (-)
G1310054 NA non-coding downstream 75763 56620934 ~ 56628935 (-)
G1310046 NA non-coding downstream 105247 56597418 ~ 56599451 (-)
G1310024 NA non-coding downstream 139316 56565100 ~ 56565382 (-)
G1310020 NA non-coding downstream 144791 56559693 ~ 56559907 (-)
G1310012 NA non-coding downstream 156215 56548275 ~ 56548483 (-)
G1310108 NA non-coding upstream 1873 56706784 ~ 56708077 (-)
G1310167 NA non-coding upstream 101108 56806019 ~ 56806694 (-)
G1310169 NA non-coding upstream 121562 56826473 ~ 56832210 (-)
G1310239 NA non-coding upstream 227285 56932196 ~ 56932643 (-)
G1310241 NA non-coding upstream 229629 56934540 ~ 56934747 (-)
G1309187 NA other downstream 649634 56054491 ~ 56055064 (-)
G1308906 NA other downstream 956945 55746285 ~ 55747753 (-)
G1308831 NA other downstream 1148124 55556232 ~ 55556574 (-)
LOC110490337 LOC106609287 other downstream 1552587 55148760 ~ 55155353 (-)
G1310261 LOC106609352 other upstream 266830 56971741 ~ 56973518 (-)
LOC110490385 LOC106576235 other upstream 420903 57125783 ~ 57143499 (-)
LOC110490387 LOC106609365 other upstream 537769 57231181 ~ 57247843 (-)
G1310744 NA other upstream 673928 57295439 ~ 57441427 (-)
G1311818 NA other upstream 1444075 58148986 ~ 58149397 (-)

Expression


G1310105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1310105 Expression in each Bioproject

Bar chart with 7 bars.
G1310105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network