G1311170



Basic Information


Item Value
gene id G1311170
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 57936903 ~ 57937328 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1495807
gcttcatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacgtaacgttttgtattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggaggcttgtggcaaactttaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaacatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagt

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1495807 True 426 lncRNA 0.45 1 57936903 57937328
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110514203 LOC106576268 coding upstream 28732 57898842 ~ 57908171 (+)
LOC118938927 LOC106576267 coding upstream 45844 57888362 ~ 57891059 (+)
LOC110490410 LOC106576264 coding upstream 55594 57872879 ~ 57881309 (+)
LOC110490411 r51a1 coding upstream 68204 57864481 ~ 57868699 (+)
LOC110490407 LOC106609462 coding upstream 123483 57808661 ~ 57813420 (+)
LOC110490416 LOC106576270 coding downstream 22252 57959580 ~ 57965064 (+)
LOC110490417 spic coding downstream 31903 57969231 ~ 57971616 (+)
LOC110490765 mybpc1 coding downstream 42586 57979914 ~ 58017024 (+)
LOC110490419 LOC106576273 coding downstream 80148 58017476 ~ 58035699 (+)
LOC100135998 LOC100135998 coding downstream 125898 58063226 ~ 58066442 (+)
G1311158 NA non-coding upstream 16988 57914651 ~ 57919915 (+)
G1311150 NA non-coding upstream 25389 57896052 ~ 57911514 (+)
G1311126 NA non-coding upstream 77850 57850917 ~ 57859053 (+)
G1311075 NA non-coding upstream 199600 57730001 ~ 57737303 (+)
G1311156 NA non-coding downstream 18175 57955503 ~ 57956765 (+)
LOC100136741 LOC100136741 non-coding downstream 164912 58102240 ~ 58136639 (+)
pmch LOC106576280 non-coding downstream 215170 58152481 ~ 58154147 (+)
LOC110490425 nup37 non-coding downstream 240630 58172956 ~ 58182616 (+)
G1311279 NA non-coding downstream 251895 58189223 ~ 58192466 (+)
G1310321 gdib other upstream 893641 57039799 ~ 57050944 (+)
G1309787 NA other upstream 1022680 56912331 ~ 56914223 (+)
G1309163 LOC100136012 other upstream 1899500 56036902 ~ 56037403 (+)
G1309147 NA other upstream 1919955 56016448 ~ 56016948 (+)
LOC110490357 LOC106609270 other upstream 2353048 55569924 ~ 55583925 (+)
LOC110490438 LOC106576294 other downstream 499216 58435813 ~ 58455629 (+)
LOC110490440 LOC106576296 other downstream 539909 58477237 ~ 58505176 (+)
LOC110490442 LOC106609443 other downstream 591586 58514317 ~ 58550337 (+)
LOC110490444 LOC106576210 other downstream 617425 58554753 ~ 58565413 (+)

Expression


G1311170 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1311170 Expression in each Bioproject

Bar chart with 20 bars.
G1311170 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network