G1313204 (LOC106576014)


Basic Information

Item Value
gene id G1313204
gene name LOC106576014
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 59984329 ~ 59984908 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1498148
TTTTCTTCTGTGGGGGATTCTGTCCTGACCCTCCCTCTCCGGTGCTGTCTCCACTTAGTGAACGAGAGAAGGCCAGCGTTCCCCCCTCCTCAGGGCAGGGGTAGAAGAGAGACCCTGCAGCCTCTGTGAAGGGTCCTGCTGCCAAGGGTACTGGTACTGTCACTGCCACAACACCAGCCACAGCCTCAGGCCTGAAGGCCAAGATGGGCTCCAGGGTGTGTGAGGGGGTAAGGTCCCTCAGGTTAGAGTTGATGGGGGAGAAGGACAGACCCCCTGGCCCTGACAGACCCACTCTCTCTGGACTCTTCATCCAGGGGGGGAGGAGCGAGGAAGAGGCTGGGTCTGTAGAGGAGGGGGTGTCGCTGCTGCCCTCGGTCCCTGTCTCTGGCCCCTCCTCTCCCACACAGTCCTGGGACTCGGGTGTGGGGGGCTGGGGGCTCAGGGGGGCGCTGGTCTTGGCCTCTTGGGGGAGCAACACATCCAGACTGGGAGCCCTGACCGCTACACAGGGGGAGGAGAGCAGCGAAGGTGGCCGCTCAGCCTCTTGGGGGCTGGGTCTGCGACTGCCCTCTGGTGAGCT

Function

NR:

description
histone-lysine N-methyltransferase 2E-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1498148 True 580 TUCP 0.64 1 59984329 59984908
Loading

Neighbor

gene id symbol gene type direction distance location
lhfpl3 lhfpl3 coding upstream 9654 59935626 ~ 59977759 (+)
LOC110490476 LOC106576353 coding upstream 62051 59917322 ~ 59922278 (+)
LOC110490472 cl031 coding upstream 107587 59874840 ~ 59876742 (+)
LOC110490468 acss3 coding upstream 434652 59518022 ~ 59549677 (+)
LOC110490466 LOC106576326 coding upstream 515091 59466597 ~ 59469238 (+)
LOC110490480 LOC106576359 coding downstream 40155 60025063 ~ 60026611 (+)
LOC110490772 LOC104968060 coding downstream 67087 60051995 ~ 60059547 (+)
LOC110490485 LOC106609495 coding downstream 522471 60507379 ~ 60520609 (+)
LOC110490488 LOC106576423 coding downstream 858916 60843824 ~ 60926356 (+)
LOC110490491 LOC106576442 coding downstream 1020729 61005637 ~ 61009062 (+)
G1313202 LOC106609379 non-coding upstream 118 59983863 ~ 59984211 (+)
G1313201 LOC106609379 non-coding upstream 1696 59981099 ~ 59982633 (+)
G1313170 NA non-coding upstream 57286 59926642 ~ 59927043 (+)
G1313164 NA non-coding upstream 69538 59913707 ~ 59914791 (+)
G1313203 NA non-coding downstream 925 59985833 ~ 59987272 (+)
G1313205 LOC106576014 non-coding downstream 11005 59995913 ~ 59996232 (+)
G1313177 LOC106609379 non-coding downstream 15748 60000656 ~ 60001871 (+)
G1313207 LOC106576014 non-coding downstream 17754 60002662 ~ 60002881 (+)
G1313208 NA non-coding downstream 18576 60003484 ~ 60003718 (+)
G1313163 NA other upstream 71461 59911208 ~ 59912868 (+)
G1313161 NA other upstream 75043 59908570 ~ 59909286 (+)
G1313160 NA other upstream 77037 59906979 ~ 59907292 (+)
G1313156 LOC106609404 other upstream 82126 59901652 ~ 59902203 (+)
G1313256 NA other downstream 113879 60098787 ~ 60100927 (+)
G1315004 NA other downstream 1521276 61506184 ~ 61506590 (+)
G1315081 NA other downstream 1574672 61559580 ~ 61559958 (+)

Expression

G1313204(LOC106576014) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1313204(LOC106576014) Expression in each Bioproject

Bar chart with 12 bars.
G1313204(LOC106576014) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network