G1313256


Basic Information

Item Value
gene id G1313256
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 60098787 ~ 60100927 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1498219
ctactacactgtacatcatgtatagtaccaacactactactacactgtacatcatgtatagcaccaacactactactacacatcatgtatagtaccaacactactactatactgtacatcatgtatagtaccaacactactactacactgtacatcatgtatagtaccaacactactactacactgtacatcatgtatagtaccaatactactactacactgtacatcatgtatagtaccaacactactactacactgtacatcatgtatagtaccaacactactactacactgtacatcatgtatagcaccaacactactactacactgtacatcatgtatagtaccaacagtactactacactgtacatcatgtatagcaccaacactactactacacatcatgtatagcaccaacactactactacacatcatgtatagtaccaacactactactacacatcatgtatagtaccaacactactactacac

Function

NR:

description
PREDICTED: oleosin-B3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1498219 True 493 TUCP 0.37 2 60098787 60100927
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110490772 LOC104968060 coding upstream 39783 60051995 ~ 60059547 (+)
LOC110490480 LOC106576359 coding upstream 72402 60025063 ~ 60026611 (+)
lhfpl3 lhfpl3 coding upstream 124112 59935626 ~ 59977759 (+)
LOC110490476 LOC106576353 coding upstream 176509 59917322 ~ 59922278 (+)
LOC110490472 cl031 coding upstream 222045 59874840 ~ 59876742 (+)
LOC110490485 LOC106609495 coding downstream 406452 60507379 ~ 60520609 (+)
LOC110490488 LOC106576423 coding downstream 742897 60843824 ~ 60926356 (+)
LOC110490491 LOC106576442 coding downstream 904710 61005637 ~ 61009062 (+)
LOC110490492 LOC106576422 coding downstream 912745 61013672 ~ 61016317 (+)
LOC110490775 LOC106576441 coding downstream 915493 61016420 ~ 61023858 (+)
G1313252 NA non-coding upstream 5488 60085772 ~ 60093299 (+)
G1313251 NA non-coding upstream 15056 60080922 ~ 60083731 (+)
G1313220 NA non-coding upstream 76135 60022016 ~ 60022652 (+)
G1313221 NA non-coding upstream 77301 60021176 ~ 60021486 (+)
G1313424 LOC106609492 non-coding downstream 323519 60424446 ~ 60425029 (+)
G1313429 NA non-coding downstream 333550 60434477 ~ 60434702 (+)
G1313454 NA non-coding downstream 365584 60466511 ~ 60466841 (+)
G1313455 NA non-coding downstream 366828 60467755 ~ 60467966 (+)
G1313451 NA non-coding downstream 368966 60469893 ~ 60470843 (+)
G1313177 LOC106609379 other upstream 96916 60000656 ~ 60001871 (+)
G1313204 LOC106576014 other upstream 113879 59984329 ~ 59984908 (+)
G1313163 NA other upstream 185919 59911208 ~ 59912868 (+)
G1315004 NA other downstream 1405257 61506184 ~ 61506590 (+)
G1315081 NA other downstream 1458653 61559580 ~ 61559958 (+)
G1315251 NA other downstream 1734519 61835446 ~ 61836074 (+)
G1315291 NA other downstream 1786137 61887064 ~ 61912414 (+)
G1315290 NA other downstream 1796926 61897853 ~ 62006721 (+)

Expression

G1313256 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1313256 Expression in each Bioproject

Bar chart with 8 bars.
G1313256 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network